Previous Article | Next Article ![]()
Eukaryotic Cell, February 2005, p. 379-391, Vol. 4, No. 2
1535-9778/05/$08.00+0 doi:10.1128/EC.4.2.379-391.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Max Planck Institute for Terrestrial Microbiology, Marburg, Germany
Received 4 August 2004/ Accepted 18 November 2004
|
|
|---|
|
|
|---|
In U. maydis, the causative agent of corn smut disease, fusion of compatible partners is genetically controlled by the biallelic a locus, encoding pheromone (mfa1/2) and receptor (pra1/2) genes (6). Subsequent filamentous growth and pathogenic development are regulated by the multiallelic b locus (4). This locus codes for two homeodomain proteins, bE and bW, which dimerize to generate an active transcription factor when derived from different alleles (16, 24). Basal as well as pheromone-induced transcription of the genes in the a and b loci is regulated by the HMG box protein Prf1, which binds to pheromone response elements (PREs) present in the regulatory regions of the a and b mating type genes (18, 51). Consequently, prf1 deletion mutants are sterile and nonpathogenic.
To perform its function, Prf1 needs to be activated through both a conserved mitogen-activated protein (MAP) kinase module consisting of Kpp4/Ubc4 (MAPKKK), Fuz7/Ubc5 (MAPKK), and Kpp2/Ubc3 (MAP kinase) (1, 4, 22, 35-37) and a conserved cyclic AMP (cAMP) signaling pathway (29, 41). Activation of the MAP kinase cascade results in prf1-dependent gene expression, and among the genes whose transcription is activated are prf1 itself, mfa, pra, bE, and bW (18, 51). In addition, the cAMP pathway triggers pheromone-responsive expression of these genes (29, 41). Cross talk between protein kinase A and MAP kinase signaling during mating is mediated by the posttranscriptional modification of Prf1 at protein kinase A as well as MAP kinase phosphorylation sites (22).
Recent experiments have indicated that the signaling pathway bifurcates downstream of the MAP kinase Kpp2. One branch leads to the described transcriptional responses, and all of these require Prf1 (18, 37). The other branch triggers conjugation tube formation, and this morphological transition is independent of prf1 (37). In addition to posttranscriptional regulation, prf1 is regulated on the transcriptional level by an upstream activating sequence (UAS) located in its promoter (19). The UAS determines expression through environmental signals (e.g., nutrients). Furthermore, two PRE boxes in the prf1 promoter are probably involved in the autoregulation of prf1 transcription.
In this study, we have investigated the roles of additional HMG domain proteins in U. maydis development. We describe the characterization of rop1 in detail, which turned out to be a transcriptional regulator of prf1 exclusively during axenic growth.
|
|
|---|
(Bethesda Research Laboratories) and Top10 (Invitrogen) were used for cloning purposes, and E. coli Rosetta(DE3)(pLysS) (Novagen) was used for protein expression. The U. maydis strains used in this study are listed in Table 1. U. maydis strains were grown as indicated at 28°C in liquid complete medium (CM) (21), nitrate minimal medium (NM) supplemented with either 1% glucose or 1% maltose (19), YEPSL (0.4% yeast extract, 0.4% peptone, 2% sucrose), or potato dextrose (PD) (2.4% PD broth [Difco]) medium or solid PD agar. For induction of the crg1 promoter, strains were grown in CM medium containing 1% glucose to an optical density at 600 nm (OD600) of 0.5, washed twice with water, resuspended in CM medium with 1% arabinose as a carbon source, and grown for the time indicated in each experiment. |
View this table: [in a new window] |
TABLE 1. U. maydis strains used in this study
|
Plasmids and plasmid construction. Plasmids pTZ19R (Pharmacia), pSP72 (Promega), pSL1180 (Pharmacia), and pBS(+)SKII (Stratagene) were used for cloning, subcloning, and sequencing of genomic fragments, and pCR2.1TOPO (Invitrogen) was used for cloning and sequencing of fragments generated by PCR. pET15b (Novagen) was used for protein expression in E. coli. Sequence analysis of genomic fragments and fragments generated by PCR was performed with an automated sequencer (ABI 377) and standard bioinformatic tools.
pMF1h contains a hygromycin resistance cassette as an SfiI fragment, and pMF1n contains a nourseothricin resistance cassette as an SfiI fragment (8). p123 is a pSP72 derivative containing the enhanced green fluorescent protein (EGFP) gene egfp (Clontech) fused to the otef promoter, an nos terminator, and a carboxin resistance cassette (53). pCU4 codes for carboxin resistance and carries the gfp gene under the control of the constitutive otef promoter (33); pAH298HMG is a pET15b derivative for the heterologous expression of the HMG domain of Prf1 comprising amino acids 1 to 289 as an N-terminally 6xHis-tagged fusion protein (18).
To isolate the hmg3 gene, a 0.77-kb PCR fragment was generated with primers hmg3uni1 (GCGGCATCAGAGCATCG) and hmg3rev2 (GGACTCAGAAGCATCGGC). The amplified hmg3 fragment was used to screen a genomic cosmid library (43). A 3.3-kb region of the hybridizing cosmid 20C9, comprising the hmg3 open reading frame, was sequenced.
The rop1 gene was subcloned from a genomic bacterial artificial chromosome library (LionBioscience) as a 7.7-kb SacII fragment into the SacII site of pBS(+)SKII, and the resulting plasmid was designated pRop1-7.7S.
cDNA of rop1 was isolated from a
gt10 cDNA library (6) by PCR. The PCR fragments were cloned in pCR2.1-TOPO to yield pTB20 to pTB25 and sequenced.
Deletion constructs were generated according to Kämper (23). In particular, for p
rop1-hyg, a 1.1-kb fragment comprising the 5' flank and a 1.0-kb fragment comprising the 3' flank of the rop1 open reading frame were generated by PCR on U. maydis FB1 DNA with primer combinations OTB27L (CATTCCCTTTCGTCGTCCTTGATC)-OTB28L2 (CACGGCTGAGTGGCCTGAAGCAGTCAAATCACGCCAGG) and OTB15R1 (GTGGGCCATCTAGGCCGCACTGAAGTCTTGACACAGATGC)-OTB16R2 (GGTCAGTACTTGATACTAAGCGCC), respectively. These fragments were then digested with SfiI and ligated to the 2.7-kb SfiI hygromycin resistance cassette from pMF1-h (8). The resulting ligation products were cloned into pCR2.1-TOPO. This plasmid, p
rop1-hyg, was subsequently used as a template to amplify the rop1 deletion construct with primers OTB27L and OTB16R2.
To generate p
hmg3-nat, a 1.0-kb fragment comprising the 5' flank and a 1.0-kb fragment comprising the hmg3 3' region from bp 1713 to 2663 were generated by PCR on U. maydis FB1 DNA with primer combinations L152uni (CGACTTGGAGAAGTGCGCG)-L152SfiIrev (ACACGGCCTGAGTGGCCTAGCGAGATGGAGTTGGGGC) and R152SfiIuni (TGTGGGCCATCTAGGCCCGGCGCGAATCAAGTACAGAGC)-R152rev (GCGATGAGTTTGGCGAGACGG), respectively. These fragments were then digested with SfiI and ligated to the 1.4-kb SfiI nourseothricin resistance cassette from pMF1n (8). The resulting ligation products were cloned into pCR2.1-TOPO to yield p
hmg3-nat. This plasmid was subsequently used as a template to amplify the hmg3 deletion construct with primers L152uni and R152rev.
Plasmid p123Potef:rop1 was constructed by replacing the 0.7-kb NcoI-NotI egfp gene fragment of p123 with a 2.2-kb NcoI-HindIII fragment from pET15bRop1 (see below) coding for the N-terminally 6xHis-tagged version of Rop1. p123Potef:rop1 carries the 6xHis::rop1 allele under the control of the constitutive otef promoter.
In pPprf11746:gfp, the prf1 gene promoter up to position 1746 is ligated to the gfp gene. To yield this plasmid, the otef promoter in pCU4 (33) was replaced by the prf1 promoter.
pET15bRop1 was constructed by ligating a 1.8-kb SalI-BglII-digested PCR product generated with primers Rop1-5'SalI (GTCGACATGGCGCAACAGGGCTATGGC) and Rop1-3'BglII (AGATCTTCAGTGCCCAGAGGCGC) encompassing the complete rop1 open reading frame into the XhoI and BamHI sites of pET15b to yield a translational 6xHis::rop1 fusion at the N terminus of rop1.
pET15bHMGRop1 was constructed by ligating a 0.91-kb SalI- and BglII-digested PCR product generated with primers Rop1HMG-5'SalI (GTCGACCTGTCCAATCATCCGACC) and Rop1HMG-3'BglII (AGATCTGTGTTGCAAGTTCGCCACG) encoding the HMG domain of Rop1 (amino acids 100 to 401 of the protein) into the XhoI and BamHI sites of pET15b to yield a translational 6xHis::rop1100-401 fusion.
For transformation into U. maydis, linear deletion constructs were generated from the deletion plasmids by PCR; pPRF1con (19) was digested with DraI, and plasmids p123Potef:rop1 and pPprf11746:gfp were linearized with SspI prior to transformation. In all cases, single homologous integration events into the respective loci were verified by Southern analysis.
DNA and RNA procedures. Standard molecular techniques were used for DNA and RNA procedures (42). Transformation of U. maydis was performed as published previously (43). U. maydis DNA was isolated as described (20). RNA from strains grown in liquid culture was prepared as described (29) or following the Trizol reagent protocol (Invitrogen). The following probes were used for Northern analyses: a 0.67-kb EcoRV fragment and a 1.3-kb EcoRI-EcoRV fragment from pSP4.2EcoRV (6) for mfa1 and pra1, respectively; a 2.6-kb PvuII fragment from pbW2-Nde-bE1 (10) for bE and bW; and a 1.6-kb EcoRV fragment from pRF-6.0B (19) for prf1. For rop1, a 0.2-kb fragment was generated with primers OTB9 (ACCTCGGCCACCTAATGC) and OTB12 (GGCGATATCGGTAGGTGG) by PCR on FB1 DNA. For hmg3, a 0.77-kb PCR product generated with primers hmg3uni1 and hmg3rev2 (see above) was used. Radioactive labeling was performed with the NEBlot kit (New England Biolabs). A 5'-end-labeled oligonucleotide complementary to the U. maydis 18S rRNA was hybridized as a loading control in Northern analyses (7). For visualization and quantification of radioactive signals, a PhosphorImager (Storm 840; Molecular Dynamics) and the program ImageQuant (Molecular Dynamics) were used.
Mating, pheromone stimulation, and pathogenicity assay. To test for mating, compatible strains were cospotted on charcoal-containing PD plates (21), and the plates were sealed with Parafilm and incubated at 28°C for 48 h. For pheromone stimulation, strains were grown in CM with 1% glucose to an OD600 of 0.6. Synthetic pheromone (kindly provided by M. Tönnies and H. Kessler) dissolved in dimethyl sulfoxide was added to a final concentration of 2.5 µg/ml, and cells were harvested for microscopic observations and RNA preparations after 5 h of incubation in a 15-ml plastic tube on a tissue culture roller at 28°C.
Plant infections of the corn variety Early Golden Bantam (Olds Seeds, Madison, Wis.) were performed as described previously (36). Fungal structures on the plant surface were visualized by Calcofluor staining as described previously (9).
Fluorimetric measurement of GFP. Cells grown in NM plus 1% glucose or 1% maltose to an OD600 of 0.5 to 0.8 were pelleted and resuspended in sterile H2O to an OD600 of 1.0; 200 µl of cell suspension was transferred to a microtiter plate, and fluorescence was measured in a Tecan Saphire fluorescence reader. GFP fluorescence was measured at a wavelength of 485 nm for excitation and 520 nm for emission, with a bandwidth of 7.5 nm in both cases. Fluorescence was normalized to the OD600 (22). At least two independent cultures were scored, and each was measured in triplicate to yield mean values.
Protein expression and purification and electrophoretic mobility shift assays.
Rosetta(DE3)(pLysS) cells containing plasmid pET15bHMGRop1 or pAH289HMG (18) were grown in dYT (1.6% trypto-peptone, 1% yeast extract, 0.5% NaCl) containing 1% glucose, ampicillin (100 µg/ml), and chloramphenicol (34 µg/ml) at 37°C. At an OD600 of
0.5, cells were shifted to 20°C, and expression was induced by the addition of 0.1 mM isopropylthiogalactopyranoside (IPTG). After overnight incubation, cells were harvested and resuspended in buffer A (20 mM Tris, pH 7.9, 0.5 M NaCl, 5 mM imidazole, 0.1 mM Triton X-100, and complete protease inhibitor cocktail [Roche]). All subsequent steps were performed on ice or at 4°C. Cells were disrupted by five passages through a French pressure cell (Minicell, 20,000 lb/in2). After centrifugation (13,000 x g, 1 h, 4°C) the cleared lysates were subjected to Ni-NTA affinity chromatography (Ni-nitrilotriacetic acid resin, Qiagen) according to the manufacturer's protocol. For washing steps, buffer A containing 60 mM imidazole was used, and elution was performed with buffer A containing 1 M imidazole. The purified His-tagged HMG domains of Rop1 and Prf1 (Rop1100-401 and Prf11-289 proteins, respectively) were desalted on PD10 columns (Pharmacia) with retention buffer (25 mM HEPES, pH 7.9, 100 mM KCl, 1 mM EDTA, 1 mM dithiothreitol, 10% glycerol, and complete protease inhibitor cocktail; see above) for elution. Fractions (0.5 ml) were collected and assayed for protein content and purity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and staining with Coomassie blue.
Electrophoretic mobility shift assays were performed with 100 to 200 ng of purified Rop1100-401 or Prf11-289 protein in retention buffer (see above) supplemented with 1 µg of bovine serum albumin and 0.4 µg of poly(dI-dC) in a total volume of 10 µl. Samples were incubated for 20 min at room temperature, 32P-labeled probe (10,000 cpm) was added, and incubation was continued for 30 min. For competition experiments, unlabeled probes were added after 10 min of incubation, and labeled probes were introduced after further incubation for 10 min.
The probes used for the experiments were consecutive (fragments a to e in Fig. 6) and overlapping restriction fragments (a1 and a2 and d1 and d2, Fig. 6) of the prf1 promoter generated by digests of plasmid pRF-6.0B (19). Fragment a is a 438-bp SphI-XhoI fragment; fragment b is a 413-bp XhoI-NdeI fragment; fragment c is a 366-bp NdeI-NspI fragment; fragment d is a 454-bp NspI-XbaI fragment; fragment e is a 427-bp XbaI-SalI fragment; fragment a1 is a 282-bp SphI-NcoI fragment; fragment a2 is a 276-bp NspI-XhoI fragment; fragment d1 is a 268-bp NspI-BpmI fragment; and fragment d2 is a 228-bp SacII-XbaI fragment. In addition, three pairs of complementary oligonucleotides were annealed to yield three double-stranded 33-bp probes with single-base 5' overhangs: PREuni (CAAATCTGTGAATCCCTTTGTGCCAGTTGACTG) annealed to PRErev (GCAGTCAACTGGCACAAAGGGATTCACAGATTT); RRS2uni (TGCAACCGACTTATTGTCCTTTCCCGAACTCCA) annealed to RRS2rev (TTGGAGTTCGGGAAAGGACAATAAGTCGGTTGC); and RRSm-uni (ATCACCATCACCCGGTGAGGGGCACCAGCGCGC) annealed to RRSm-rev (AGCGCGCTGGTGCCCCTCACCGGGTGATGGTGA). Equimolar amounts of the DNA fragments were 5'-end labeled by T4 polynucleotide kinase (New England Biolabs) and [
-32P]ATP (6,000 Ci/mmol) according to the manufacturer's instructions.
![]() View larger version (52K): [in a new window] |
FIG. 6. Rop1 binds to specific sequences in the prf1 promoter in vitro. (A) Schematic representation of the prf1 promoter. The UAS is indicated as an open arrow, RRS sequences are depicted as black triangles, and open triangles denote putative additional RRS motifs as suggested by sequence similarity and electrophoretic mobility shift assays. PRE elements are indicated as light grey rectangles, open rectangles denote putative additional PRE elements as suggested by sequence similarity and electrophoretic mobility shift assays. Numbers below indicate positions relative to the ATG. Promoter fragments used in electrophoretic mobility shift assays are indicated as arrows below the scheme. The inset to the right gives the sequences of the three RRS sites identified. Bases present in all three RRS motifs are given in bold. For comparison, the PRE box, a half site of the hypoxic operator (HOP) recognized by Rox1p in S. cerevisiae, and the TR element recognized by Ste11 in S. pombe are shown. (B to E) Electrophoretic mobility shift assays with His-tagged HMG domains of Rop1 and Prf1 protein with (B) prf1 promoter fragments a to e and (C) prf1 promoter fragments a1 and a2 and d1 and d2. (D) Interaction of the Rop1 HMG domain with labeled RRS2 oligonucleotide was analyzed in the presence of increasing amounts (given as fold molar excesses) of the different unlabeled competitors indicated above the lanes. In lane 15, binding of the Prf1 HMG domain to the RRS2 probe was tested in the absence of competitor. (E) Interaction of the Prf1 HMG domain with labeled PRE oligonucleotide was analyzed in the presence of increasing amounts (given as fold molar excess) of the different unlabeled competitors indicated above the lanes. Binding of the Rop1 HMG domain to the PRE probe was tested in the absence of any competitor (lane 1).
|
Microscopic observation. For microscopic observation, a Zeiss Axiophot microscope with differential interference contrast optics was used. Calcofluor fluorescence was observed with a standard DAPI (4',6'-diamidino-2-phenylindole) filter set. GFP fluorescence was detected with a specific filter set (BP 470/20, FT493, BP 505 to 530; Zeiss, Jena, Germany). Pictures were taken with a charge-coupled device camera (Hamamatsu, Herrsching, Germany). Image processing was done with Image Pro (Media Cybernetics), Adobe Photoshop 6.0, and Canvas 6.0 (Deneba Systems).
Nucleotide sequence accession numbers. The GenBank accession numbers for rop1 and hmg3 are AY677184 and AY677183, respectively.
|
|
|---|
![]() View larger version (15K): [in a new window] |
FIG.1. U. maydis genome contains three sequence-specific HMG domain proteins. (A) Bootstrap analysis (with Clustal X [48] and neighbor-joining plot programs) of the nine HMG domains encoded by the U. maydis genome compared to sequence-specific and non-sequence-specific HMG domains of several fungal species. Amino acid positions in the proteins are given as lowercase numbers. ABF243-111 (S. cerevisiae, accession no. sp|Q02486), Cmb1141-220 (S. pombe, accession no. sp|Q10241), NHP6A21-89 (S. cerevisiae, accession no. sp|P11632), FPR1169-237 (Podospora anserina, accession no. sp|P35693) Mta-1116-184 (Neurospora crassa, accession no. sp|P36981), Mat2 (Gibberella fujikuroi; accession no. dbj|BAA75905.1), Mat1-Mc103-171 (S. pombe, accession no. sp|P10840), Pcc124-98 (C. cinereus, dbj BAA33018
[GenBank]
1), Ste1116-80 (S. pombe, accession no. sp|P36631), ROX110-83 (S. cerevisiae, accession no. sp|P25042), and Mat1-2129-203 (C. heterostrophus, accession no. pir|S34811). The HMG domains of Prf1126-197 (accession no. gb|AAC32736), Rop1215-295 (accession no. gb|AY677184), and Hmg357-140 (accession no. gb|AY677183) cluster with the sequence-specific class, whereas the other six Ustilago HMG domains given as annotation codes (http://mips.gsf.de/genre/proj/ustilago) appear in the non-sequence-specific class. (B) Schematic representation of U. maydis Rop1, Prf1, and Hmg3 domain structure. Features were identified with the PrositeScan and PSORT engines. Putative MAP kinase (diamonds) and protein kinase A (grey ellipses) phosphorylation sites are shown; numbers above the line indicate MAP kinase phosphorylation sites, and numbers below protein kinase A phosphorylation sites. The HMG domains are represented by open rectangles, and the potential nuclear localization sequences (NLS) are depicted as black ellipsoids. The numbers on the right indicate the sizes of the proteins in amino acids.
|
The HMG domain of Hmg3 shows closest homology to Mat2 from Gibberella fujikuroi. The intronless hmg3 gene comprises 2,604 bp and codes for a protein of 867 amino acids that is predicted to be localized in the nucleus (http://psort.nibb.jp) but does not contain an obvious nuclear localization sequence. Hmg3 carries four potential MAP kinase (Fig. 1B) and two potential protein kinase A phosphorylation sites (http://www.expasy.org/cgi-bin/scanprosite) (Fig. 1B), respectively.
rop1 is required for mating. To analyze the cellular functions of these putative transcription factors, we constructed rop1 and hmg3 deletion strains. To this end the genes in strains FB1 (a1 b1), FB2 (a2 b2), and SG200 (a1::mfa2 bE1 bW2) were replaced with either a hygromycin or nourseothricin resistance cassette (see Materials and Methods for details). The resulting deletion strains were viable, showed no apparent growth defect (not shown), and displayed a budding pattern indistinguishable from that of wild-type strains (see below).
To test for mating, compatible deletion strains were cospotted on PD-charcoal plates. On these plates compatible wild-type strains fuse and form dikaryotic hyphae, which appear as white fuzziness (Fig. 2A). When cospotted with an a2 b2 wild-type partner, compatible FB1
rop1 strains displayed slightly attenuated filamentation, while compatible mixtures of an a1 b1 wild-type strain and FB2
rop1 strains showed significant reduction in filament formation (Fig. 2A). This might be due to different genetic backgrounds of the a1 b1 and a2 b2 strains. However, mixtures of compatible
rop1 strains were unable to develop dikaryotic hyphae (Fig. 2A), indicating that rop1 is required for successful recognition or fusion with a compatible partner. The
rop1 phenotype could be complemented by introducing the rop1 gene under the control of the constitutive otef promoter into a rop1 deletion strain (Fig. 2A). In addition, the effects of the rop1 deletion were studied in the solopathogenic SG200 strain. The SG200 wild-type strain shows filamentous growth on PD-charcoal plates because of autocrine pheromone stimulation and the presence of an active bE/bW heterodimer (Fig. 2B) (5). SG200
rop1 strains were nonfilamentous (Fig. 2B), which suggests a postfusion role for Rop1.
![]() View larger version (46K): [in a new window] |
FIG. 2. Mating and filamentation defects of rop1 and hmg3 deletion strains. The strains indicated on top are FB1 (a1 b1) and SG200 (a1::mfa2 bE1 bW2) derivatives. Strains indicated to the left are FB2 (a2 b2) derivatives. Indicated wild-type (wt) and mutant strains were spotted alone or in combinations on charcoal-containing PD plates. Dikaryotic and b-dependent filaments appear as white fuzziness.
|
hmg3 strains (Fig. 2C). Filamentation of the solopathogenic SG200
hmg3 strains was similar to that of the respective wild type (Fig. 2D). This indicates minor defects in cell fusion of hmg3 deletion strains.
rop1 is essential for conjugation tube formation upon pheromone stimulation, while hmg3 is not.
To examine the roles of these two HMG box proteins in the pheromone signaling pathway, we tested the deletion strains for their ability to form conjugation hyphae upon stimulation with synthetic pheromone (47). When stimulated with pheromone, wild-type cells react with the formation of conjugation hyphae, and this morphological transition could also be observed with hmg3 mutant cells (Fig. 3A). In contrast, pheromone-stimulated
rop1 cells were unable to form conjugation hyphae (Fig. 3A). On these grounds, we concentrated on further characterization of rop1, which is essential for conjugation tube formation.
![]() View larger version (52K): [in a new window] |
FIG. 3. Influence of rop1 and hmg3 deletions on conjugation tube formation. (A) The FB1 (a1 b1) wild-type (wt) and mutant strains indicated on top were stimulated with a2 pheromone for 5 h (lower panel) or treated with dimethyl sulfoxide for the same period of time (upper panel). All pictures were taken at the same magnification. Bar, 20 µm. (B) All strains indicated on top are derivatives of FB1Pcrg1::fuz7DD, encoding an arabinose-inducible, constitutively active allele of the MAPKK Fuz7. Cell morphology after 5 h in arabinose-containing medium (lower panels) was compared to that of cells grown with glucose as the carbon source for the same period of time (upper panels). All pictures were taken at the same magnification. Bar, 20 µm.
|
rop1 strain developed conjugation tubes as efficiently as the progenitor strain (Fig. 3B). This makes it unlikely that Rop1 is the transcription factor regulating conjugation tube formation downstream of the MAP kinase cascade.
To check for redundant functions of Rop1, Hmg3, and Prf1 in this process, we examined
prf1
rop1 and
rop1
hmg3 double mutants. Again, arabinose induction of fuz7DD resulted in efficient formation of conjugation hyphae in these strains (Fig. 3B), making it unlikely that these transcription factors can substitute for each other.
Rop1 is essential for pheromone-responsive gene expression. To further dissect the role of rop1 during mating, we performed Northern analyses of prf1, pra1, mfa1, bE, and bW after pheromone treatment of rop1 mutant and wild-type cells as controls (Fig. 4). As shown before (51) the pheromone-responsive genes prf1, bE1, W1, pra1, and mfa1 showed a basal level of expression (Fig. 4A, lanes 1 and 3) which was strongly induced upon stimulation with compatible pheromone (Fig. 4A, lane 4). In contrast, in rop1 mutants, neither basal nor pheromone-induced transcription of these genes could be detected (Fig. 4A, lanes 5 and 6).
![]() View larger version (58K): [in a new window] |
FIG. 4. rop1 is required for pheromone-responsive gene expression. RNA was prepared from the strains listed on top and subjected to Northern analysis. (A) All strains indicated on top are FB1 (a1 b1) derivatives. Cells were either untreated (lanes 1 and 2) or treated for 5 h with synthetic a2 pheromone dissolved in dimethyl sulfoxide (+) or with the same volume of dimethyl sulfoxide () (lanes 3 to 6); 10 µg of total RNA was loaded per lane. The blot was probed successively with the gene probes indicated on the right. (B) All strains used are derivatives of strain FB1Pcrg1::fuz7DD. Strains were grown with glucose () or arabinose (+) as the carbon source. RNA was isolated, and 12 µg of total RNA was loaded per lane. The filter was hybridized in succession with the gene probes indicated on the right. The rRNA probe served as a loading control. Arrowheads mark the three rop1 transcripts.
|
Regulation of rop1 gene expression. Northern analyses of rop1 gene expression in haploid cells revealed the presence of three rop1 transcripts of different sizes. Whereas the amounts and ratios of these transcripts remained unaffected by pheromone stimulation (Fig. 4A, lanes 3 and 4), the expression of the constitutively active MAPKK Fuz7DD induced the disappearance of the larger transcript (Fig. 4B, lanes 1 and 2) and enhanced the amounts of the smallest rop1 transcript (Fig. 4B, lanes 1 and 2). Moreover, the MAP kinase Kpp2 was required for the accumulation of all rop1 transcripts (Fig. 4B, lanes 3 and 4), while deletion of prf1 did not affect the amounts and ratios of the rop1 transcripts (Fig. 4B, lanes 6 and 7). This demonstrates that kpp2 but not prf1 is involved in the transcriptional regulation of rop1.
To rule out the possibility that the MAP kinase Kpp6 (9) represses rop1 gene expression in the absence of Kpp2 protein, we have analyzed rop1 transcript levels under conditions where the MAP kinase module was genetically activated in the presence of either wild-type Kpp2 or the unphosphorylatable Kpp2AEF version (37). In the strain expressing Kpp2AEF, significantly lower levels of rop1 transcripts were detected (not shown; H. Eichhorn and R. Kahmann, unpublished). This illustrates that a functional Kpp2 protein is required for rop1 expression. Since the rop1 gene contains two introns of 462 and 441 bp in its 5' region, we considered the larger transcripts to be unspliced variants. Some hints that would support this notion came from the sequencing of 5'- and 3'-rapid amplification of cDNA ends (RACE) products (data not shown). 5'-RACE experiments revealed the existence of four RNA species corresponding to unspliced, spliced for either the first or second intron, or spliced at both introns (not shown). 3'-RACE with an oligo(dT) primer amplified only the rop1-specific product without introns, indicating that the unspliced or partially spliced rop1 RNAs are not polyadenylated (not shown). Taken together, these data indicate that the MAP kinase module is required for rop1 expression as well as for correct processing of the rop1 message.
rop1 defects are complemented by constitutive expression of prf1.
To substantiate the assertion that the observed phenotypes of rop1 mutants are due to the insufficient expression of prf1 we replaced the native prf1 promoter with the constitutive tef promoter in the
rop1 background. The constitutive expression of prf1 in compatible rop1 deletion strains restored mating on charcoal (Fig. 5), indicating that Rop1 is an important regulator of prf1.
![]() View larger version (39K): [in a new window] |
FIG. 5. Constitutive expression of prf1 restores mating of rop1 deletion strains. The strains indicated on top are FB1 (a1 b1) derivatives. Strains indicated to the left are FB2 (a2 b2) derivatives. The indicated wild-type (wt) and mutant strains were spotted alone or in combinations on charcoal-containing PD plates. Dikaryotic filaments appear as white fuzziness.
|
|
View this table: [in a new window] |
TABLE 2. Influence of rop1 deletion on UAS activity and pheromone induction of the prf1 promoter
|
To map the binding sites more precisely, fragments a and d were digested into two overlapping fragments and used in electrophoretic mobility shift assays (Fig. 6C). Again, Prf11-289 only showed significant interaction with the PRE-containing fragment d1 (Fig. 6C, lane 9). Under the same conditions, purified Rop1100-401 showed strong binding to prf1 promoter fragments a and d (Fig. 6B, lanes 2 and 11), whereas for fragments b, c, and e only very weak interactions could be observed (Fig. 6B, lanes 5, 8, and 14). To delineate the Rop1 recognition site, the high-affinity-binding fragments a and d were digested into two overlapping fragments and used in electrophoretic mobility shift assays (Fig. 6C). This experiment revealed a strong specific interaction of Rop1100-401 with fragments a1 and d2 (Fig. 6C, lanes 2 and 11), while the interaction with fragment d1 was only weak (Fig. 6C, lane 8).
A comparison of the DNA sequences of fragments a1 (without the a2 overlap) and d2 led to the identification of three nearly identical sequence stretches of 11 bp with the consensus ATTGT(T/C)(C/T)T(A/T)TC with significant similarities to binding sites of other sequence-specific HMG domain proteins (Fig. 6A). This motif is exclusively present in the Rop1100-401 binding fragments of the prf1 promoter (Fig. 6A, fragments a and d), which made it a good candidate for a Rop1 recognition site (RRS). To test this directly, synthetic double-stranded oligonucleotides comprising one of the three putative RRS sequences were tested in electrophoretic mobility shift assays. Indeed, Rop1100-401 showed a high affinity for all three oligonucleotides, whereas Prf1 did not (Fig. 6D, data shown for RRS2, lanes 2 and 15).
To demonstrate specificity of the DNA-protein interactions, we performed competition experiments by adding increasing amounts of unlabeled oligonucleotides comprising either the PRE box (TCCCTTTGT), the RRS2 element (ATTGTCCTTTC), or a mutagenized RRS motif (RRSm; CGGTGGAGCGA). The retarded Rop1 RRS2 complex was competed efficiently with a 10-fold molar excess of RRS2 oligonucleotide (Fig. 6D, lanes 3 to 6), while a 100-fold molar excess of the PRE oligonucleotide was required for significant competition (Fig. 6D, lanes 7 to 10). As expected for a sequence-specific interaction, the RRSm oligonucleotide containing the mutagenized RRS motif showed no competition at all (Fig. 6D, lanes 11 to 14). This demonstrates that Rop1100-401 protein binds sequence-specifically to the RRS motif in vitro. In addition, Rop1100-401 showed a very weak affinity for the related PRE box (Fig. 6E, lane 1). This serves to explain the weak interaction of Rop1100-401 protein with the prf1 promoter fragment d1 containing two PRE boxes (Fig. 6C, lane 8). On the other hand, only the PRE (Fig. 6E, lanes 4 to 7) but not the RRS2 (Fig. 6E, lanes 8 to 11) or the RRSm oligonucleotide (Fig. 6E, lanes 12 to 15) was efficient in competing with Prf1 binding to the labeled PRE oligonucleotide (Fig. 6E). Taken together, these results demonstrate that the HMG domains of Rop1 and Prf1 recognize distinct elements in the prf1 promoter.
rop1 deletion strains are fully pathogenic.
To analyze the role of rop1 during pathogenic development, we performed plant infections with crosses of compatible rop1 deletion strains. As prf1 deletion strains are nonpathogenic and rop1 is essential for prf1 gene expression, we were surprised to observe disease symptoms with compatible
rop1 strains which were as severe as symptoms induced by wild-type strains (Table 3). This result suggests that rop1 is dispensable for prf1 gene expression during infection.
|
View this table: [in a new window] |
TABLE 3. Pathogenicity of rop1 deletion strains
|
![]() View larger version (65K): [in a new window] |
FIG. 7. rop1 is dispensable for prf1 gene expression and fungal development on the plant surface. All strains carried one copy of a transcriptional prf1 promoter-gfp fusion (Pprf1::gfp) integrated into the ip locus. (A) The FB2 (a2 b2)-derived strains are indicated on top; they were stimulated with compatible a1 pheromone for 5 h (lower panel) or treated with dimethyl sulfoxide for the same period of time (upper panel). The right panels show GFP fluorescence of the same cells depicted on the left. All pictures were taken with the same magnification. Bar, 4 µm. (B) Mixtures of compatible wild-type (wt) or compatible rop1 strains carrying the reporter (Pprf1::gfp) were spotted on charcoal-containing PD plates. The cell mixtures indicated on top were microscoped after 1 day of incubation. Lower panels show GFP fluorescence of the differential interference contrast-visualized cells depicted in the upper panels. All pictures were taken at the same magnification. Bar, 20 µm. (C and D) Mixtures of compatible strains at various stages of development (sporidia, conjugation hyphae, matings, and appressoria) on the plant surface. (C) Wild-type strains. (D) rop1 mutants. Pictures were taken as indicated on the right with a DAPI filter after Calcofluor staining (upper panels) or a GFP filter to visualize reporter gene expression (lower panels). All pictures were taken at the same magnification. Bar, 4 µm.
|
rop1 strains, basal expression of the reporter gene was reduced twofold and fivefold in the FB2- and FB1-derived strains, respectively, and pheromone treatment did not elicit an increase in Pprf1::gfp expression (Table 2). These results confirmed the Northern data on prf1 gene expression (Fig. 4A, lanes 3 to 6). To monitor gfp expression during mating conditions in axenic culture, mixtures of FB1Pprf1::gfp and FB2Pprf1::gfp as well as FB1
rop1Pprf1::gfp and FB2
rop1 Pprf1::gfp were cospotted on PD-charcoal plates for 24 h and 48 h at 28°C and then subjected to microscopic analysis. While the wild-type strains efficiently formed dikaryotic hyphae which showed strong GFP fluorescence (Fig. 7B), not a single mating event or dikaryon could be observed in mixtures of
rop1 strains, and the budding cells displayed little or no GFP fluorescence (Fig. 7B). These findings underscore that rop1 is essential for prf1 gene expression during axenic growth. However, when the same strain combinations were used to infect plants, conjugation hyphae, dikaryotic filaments, and appressorium-like structures could be detected in wild-type (Fig. 7C) as well as
rop1 derivatives (Fig. 7D). In addition, GFP fluorescence was visible in all these structures (Fig. 7C and D). This demonstrates that the prf1 gene is expressed in the plant environment even in the absence of rop1. |
|
|---|
HMG domain proteins as developmental regulators in fungi. The two additional transcription factors, Rop1 and Hmg3, identified in this study belong to the sequence-specific DNA binding class of HMG domain proteins. We demonstrate that rop1 is essential for basal and induced expression of prf1, and this explains all phenotypes of the rop1 deletion strains associated with mating, pheromone-responsive gene expression, and dikaryon formation during axenic growth. The observation that constitutive expression of prf1 complements the mating defect of rop1 deletion strains reinforces the notion that Rop1 is a transcriptional activator for prf1, and this was further substantiated by demonstrating direct binding to the prf1 promoter (see below). Therefore, we conclude that Rop1 directly activates the transcription of prf1.
A similar situation exists in Schizosaccharomyces pombe, where the HMG domain protein Ste11 (45, 46) directly activates the expression of mat1-mc. mat1-mc also encodes a sequence-specific HMG domain protein which acts as a transcriptional activator of M-cell-specific genes required for mating, sporulation, and meiosis (25, 27). In contrast to rop1 deletion strains,
hmg3 strains were only slightly impaired in cell fusion, and it is presently unclear which component of the fusion machinery is affected in these strains. The finding that neither rop1 nor hmg3 nor prf1 (37) is required for conjugation tube formation when this pathway is genetically activated by expressing the constitutively active MAPKK Fuz7DD argues against an involvement of sequence-specific HMG domain proteins as mediators of this morphological transition.
Rop1 target sites. The prf1 promoter has previously been shown to underlie a complex regulation. While the PREs in the proximal part of the prf1 promoter most likely confer autoregulation through the prf1 gene product itself, the distal UAS has been shown to be essential for the transcription of prf1 and is subject to nutritional regulation (19). As rop1 deletion strains show the same level of UAS::gfp reporter gene expression as the wild-type strain HA232, we conclude that Rop1 does not regulate prf1 gene expression via the UAS. Instead, electrophoretic mobility shift assays combined with quantitative competition experiments applying specific and unspecific oligonucleotides demonstrate that the Rop1 HMG domain specifically binds to RRS elements in the prf1 promoter. The RRS element (consensus: ATTGT[C/T][C/T]T[A/T]TC) is distinct from the PRE boxes (consensus: TCCCTTTGT) and is not recognized by the HMG domain of Prf1. For the two HMG domain proteins Ste11 and Mat1-Mc of S. pombe, it has been demonstrated that they both bind the TR element (consensus: ttTCTTTGTT) with approximately the same affinity (27).
When compared with the RRS motif sequence, similarity is most prominent in the 3' portion. The 5' portion of the RRS shows striking similarity to the motif YYYATTGTTCTC, which is recognized by Rox1p, the sole sequence-specific HMG domain protein in S. cerevisiae (2). In contrast to Rop1, which acts as an activator of prf1 expression, Rox1p functions as a repressor for genes required during oxygen limitation (57). Interestingly, in the human pathogen C. albicans the HMG domain protein Rfg1, which recognizes the same sequence element as Rox1p in S. cerevisiae, is not involved in the response to low oxygen but controls hyphal growth (26). The Rop1 binding RRS motif identified in this study is also found in a number of other promoter regions in U. maydis. This implicates Rop1 in the transcriptional regulation of a variety of other genes besides prf1. The fact that we were unable to detect additional phenotypes except the effects on prf1 may indicate that the expression of this set of genes is not relevant under the culture conditions applied.
Regulation of rop1 gene expression and protein activity. The observation that rop1 is essential for prf1 and pheromone-responsive gene expression in strains with a genetically activated MAP kinase cascade makes it likely that rop1 functions downstream of the MAP kinase Kpp2. This notion is supported by the observation that rop1 gene expression is regulated by this pathway. Of the three rop1 transcripts detected by Northern blot, only the smallest appears to be polyadenylated and completely spliced and is therefore likely to represent mature rop1 mRNA. In kpp2 deletion strains, the induction of fuz7DD by the shift from glucose to arabinose medium does not allow us to detect spliced rop1 transcripts, while these are readily detectable when the same experiment is done in the presence of Kpp2. This rules out that the shift to arabinose-containing medium is promoting the processing of rop1 message and implicates Kpp2 in the generation of these spliced transcripts. How this is achieved is presently unknown. However, precedence for a role of a MAP kinase module in splicing exists. In human cell lines, alternative splicing of CD44 pre-mRNA is regulated via phosphorylation of the RNA-binding protein Sam68 by the ERK kinase (34, 54).
The presence of potential MAP kinase phosphorylation sites in Rop1 may indicate that Kpp2 is not only involved in generating the mature rop1 transcript but may also affect the activity of Rop1 protein.
Rop1 is a critical factor for the regulation of prf1. While Rop1 is a critical factor for the regulation of prf1 during mating and dikaryon formation in axenic culture, rop1 is dispensable for pathogenic development. This came as a surprise because prf1 is not only essential during mating in axenic culture but also crucial for mating on the leaf surface and subsequent pathogenic development (18). This implies that on the leaf surface, prf1 gene expression must be induced by the perception of an as yet unidentified environmental signal not present during axenic growth. In the phytopathogenic fungi M. grisea, Colletotrichum gloeosporioides, and Uromyces appendiculatus, surface hydrophobicity and leaf topography, plant hormones, and wax components have been reported to be perceived and to induce appressorial differentiation (28, 50).
In U. maydis there is no evidence that hydrophobicity alone is sufficient to stimulate prf1 gene expression in the absence of rop1 (T. Brefort, unpublished data), which could indicate that chemical rather than physical signals serve as major stimuli. In any case, the signal must bypass the need for rop1. This points to the existence of an as yet unidentified transcription factor with an essential role in prf1 expression during fungal growth on the plant surface. The transmission of the postulated environmental signal might occur via the described cAMP or MAP kinase pathways (37) or an additional pathway acting in parallel. In this scenario, the UAS-mediated regulation of prf1 gene expression could be important. Interestingly, the IME2-like MAP kinase Crk1 was recently described to regulate prf1 expression via the UAS (14, 15). It is thus conceivable that Crk1 might be responsible for activation of the unknown transcription factor acting via the UAS. We are currently trying to isolate the regulator that promotes prf1 transcription through the UAS to sort out the complex mode of regulation affecting the prf1 promoter.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»