Previous Article | Next Article ![]()
Eukaryotic Cell, December 2005, p. 2140-2152, Vol. 4, No. 12
1535-9778/05/$08.00+0 doi:10.1128/EC.4.12.2140-2152.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
Bosl Noh,2,
Richard D. Vierstra,2
Jennifer Loros,1,3 and
Jay C. Dunlap1*
Departments of Genetics,1 Biochemistry,Dartmouth Medical School, Hanover, New Hampshire 03755,3 Department of Genetics, 425-G Henry Mall, University of WisconsinMadison, Madison, Wisconsin 537062
Received 16 July 2005/ Accepted 29 September 2005
|
|
|---|
|
|
|---|
120-kDa polypeptides, each bearing a single bilin (or linear
tetrapyrrole) chromophore. The bilin is bound covalently by an
autocatalytic mechanism to an N-terminal pocket that, once assembled,
serves as the sensory module
(73). Through
interactions between the bilin and the apoprotein, Phys reversibly
photointerconvert between two stable conformers, an R-absorbing Pr form
that is biologically inactive and an FR-absorbing Pfr form that is
biologically active. Via interconversion between Pr and Pfr, Phys act
as reversible switches in photoperception. The C-terminal half of Phys
bears contacts for dimerization and sensory output activities, the
nature of which is currently unclear (reviewed in references
58 and
71). The deluge of genomic sequence information has greatly expanded the Phy family, with new members added for plants, as well as cyanobacteria, eubacteria, actinobacteria, filamentous fungi, and possibly even slime molds (reviewed in references 50 and 72). Some Phys were even discovered that employ Pr as the active form or that work backwards, using Pfr and not Pr as the ground state. The breadth of this collection highlights the importance of light to both photosynthetic and nonphotosynthetic organisms, and it now provides new models to decipher the functions of these pigments. The filamentous fungus Neurospora crassa in particular offers the possibility of studying Phy function in a simple, genetically tractable eukaryote without the complications of photosynthesis.
A number of photoresponses are already known in Neurospora that are activated by blue light, including mycelial carotenoid biosynthesis, formation of vegetative spores (macroconidia), and phase shifting and photosuppression of circadian rhythms. Blue light also exerts its influence during the sexual cycle by inducing photodifferentiation and positive phototropism of perithecial beaks (reviewed in reference 20). Two important components of blue-light perception are the transcription factors WHITE COLLAR-1 (WC-1) and WHITE COLLAR-2 (WC-2) (4, 45, 46), which function as heterodimers in activating a battery of light-induced genes (22, 29). WC-1 binds a flavin chromophore and acts as the photoreceptor. Blue-light absorption triggers the multimerization of WC-1 and WC-2, presumably to allow multiple WC activation domains to act in tandem (22, 29). wc-1KO and wc-2KO strains are "blind" to all known blue-light-regulated processes (13, 16, 42, 44), which suggested initially that WC-1 is the only photoreceptor in this species. However, three more potential blue-light photoreceptors have been identified in the complete genomic sequence, including VIVID (VVD) and sequence relatives of plant phototropin (PHOT) and cryptochrome (CRY) (20, 21). Upon binding a flavin to a light-oxygen-voltage domain similar to the LOV domain of WC-1, VVD photoregulates the gating of light input to the circadian clock, down regulates light-induced genes, and activates via a photoadaptation response a collection of light-induced genes in response to increased illumination (30, 65). VVD is expressed only in the light; this expression requires a functional WC-1/WC-2 complex, explaining why wc-1KO and wc-2KO strains are insensitive to blue-light responses regulated by VVD (13, 65). Similarly, the expression of Neurospora CRY is photoregulated by the WC-1/WC-2 complex (A. C. Froehlich, J. Loros, and J. C. Dunlap, unpublished data). Although the role(s) of this CRY is still unclear, it is possible that some of the actions attributed to WC-1/WC-2 are in fact directed by CRY. The PHOT-like gene does not appear to be light regulated, and a link to blue-light photobiology of Neurospora remains to be established (A. Mehra, C. Heintzen, and J. C. Dunlap, unpublished results). A possible green-light photoreceptor, NOP-1, whose sequence is related to that of opsin, has also been identified (6). Although no light-specific function has been ascertained for NOP-1, it assembles in vitro with all-trans retinal to form a green-light-absorbing pigment(7).
The discovery of two Phy sequences in the Neurospora genome (8, 24) adds additional complexity to its photobiology, especially since no R/FR-regulated biology has been found in this fungus. In the present study, we initiated a molecular genetic, biochemical, and physiological investigation of phy-1 and phy-2. Analysis of the corresponding cDNAs provided the full-length amino acid sequences and revealed alternative splice isoforms that would synthesize severely truncated versions of each protein. Like other members of the Phy superfamily, recombinant PHY-2 assembles with bilins in vitro to generate R/FR photochromic pigments. We found that light does not regulate the abundance of either set of mRNAs, but the abundance of the phy-1 transcripts is circadian-clock regulated. The PHY-1 protein exists in both unphosphorylated and phosphorylated forms; this phosphorylation state is not regulated by the circadian clock and does not appear to affect the abundance or subcellular localization of the holoprotein. A thorough study of the previously documented photobiology in Neurospora failed to identify functions for PHY-1 and -2, suggesting that these pigments control one or more novel photoresponses. To our knowledge, this report is the first in-depth analysis of Phys from the fungal kingdom.
|
|
|---|
The general conditions for
growth and manipulation are described elsewhere
(18). Liquid culture
experiments were performed at 25°C as previously described
(2,
17), using a growth
medium containing 1x Vogel's, 2% glucose, 0.5% arginine, and 50
ng/ml biotin. For the expression analysis of phy-1,
phy-2, frq, al-2, and con-6
following light exposure, cultures were irradiated with
40
µmol photons/m2/s of white light (GE cool white
fluorescent bulbs; F20T12.CW) of the indicated durations, following a
20-h dark incubation. R and FR experiments were performed using an
E-30LED growth chamber equipped with R- and FR-emitting diodes
(Percival Scientific, Inc., Perry, IA).
Race tube experiments using a medium containing 1x Vogel's, 0.1% glucose, 0.17% arginine, 50 ng/ml biotin, and 1.5% Bacto agar have been described elsewhere (2). Race tubes entrained with a constant light (LL) to constant dark (DD) transfer were grown in LL for 24 h (at 25°C) and then shifted to DD (at 25°C). Conidiation density was determined and calculations of period length were performed using CHRONO (59). For the growth rate studies, race tubes were inoculated and placed at 25°C in LL for 48 h; the ends were then sealed with parafilm, and the race tubes were transferred to the appropriate lighting conditions (25°C).
The perithecial phototropism assays were
performed essentially as described by Harding and Melles, except that
Westergaard's synthetic crossing medium was used
(18,
28). In
brief, strains were inoculated onto crossing plates and kept at
25°C in DD for 7 days. Fifty microliters of conidial suspension
(strain 328-4) was pipetted as a thin line along the diameter of the
plate, and the plates were returned to the dark. The plates were
exposed to a 12-h light-12-h dark cycle (the light was provided
by fluorescent lighting), with the plates positioned in a box with a
4-cm-wide opening so that the direction of the light was perpendicular
to the line of perithecia. Perithecial beaks were scored
14
days after inoculation, with the orientation of the beaks (toward,
neutral, or away) scored relative to the direction of the light. For
the dark-grown samples, an arbitrary "direction" was
chosen for scoring purposes.
Targeted disruption of phy-1 and phy-2. Constructions were generated in which the 5' and 3' sequence flanking each open reading frame (ORF) was appended to the hygromycin B phosphotransferase (hph) coding region, whose expression was driven by the Aspergillus nidulans trpC promoter, thus allowing selection by hygromycin B resistance. These deletion constructions were transformed into Neurospora, and hygromycin-resistant transformants containing single homologous integrations of the DNA were backcrossed to the wild type (wt) to obtain homokaryotic deletion strains, as judged by DNA gel blot analysis of genomic DNA (data not shown). A phy-1AF1/phy-2AF1 double mutant was created by using the single mutants as parents in a sexual cross following standard methods.
The phy-2 disruption was prepared with the pAF68 construct, which contains the trpC::hph selection marker flanked 5' and 3' by 0.9 kb and 1.7 kb, respectively, of the phy-2 locus. pAF68 was created by three subsequent subcloning steps. The 5' phy-2 sequence was PCR amplified from genomic DNA using primers ACF93 (tacttagggcccTTCAAGTTACTAGCCCTATCACCAC)and ACF89 (ACTCGCATATGAACAGATCAGTGTC), digested with ApaI/XbaI, and ligated into ApaI/SpeI-digested pAF35 (22), resulting in pAF63. (Primer sequences in uppercase match the sequence of the target site, whereas lowercase sequences were added to the primer to aid in subsequent cloning of fragments.) The 3' phy-2 sequence was PCR amplified using primers ACF86 (ataagaatgcggccgcGTCTCGAATCTCAAGCCACCTTCAC) and ACF90 (CGCTTATGGGAATAGTGTGCTGATG), digested with BamHI/NotI, and ligated into BamHI/NotI-digested pAF63, resulting in pAF64. The EcoRI fragment from pCSN44 (69), containing the trpC promoter, was ligated into EcoRI-digested pAF64, resulting in pAF68.
The pAF69 construct was used to generate the phy-1 disruption and contains trpC::hph flanked 5' and 3' by 1.4 kb and 1.4 kb, respectively, of the phy-1 locus. pAF69 was created by three subsequent subcloning steps. The 3' phy-1 sequence was PCR amplified from genomic DNA using primers ACF92 (GTACAAAGTTACCCACGCCTTGAAC) and ACF88 (ataagaatgcggccgcCCACTATACTACAATCCCGCAGAAC), digested with MluI/NotI, and ligated into MluI/NotI-digested pAF35, resulting in pAF65. The 5' phy-1 sequence was PCR amplified using primers ACF87 (gctctagaGATATCACGCAGCTTCCTAAACAACAC) and ACF91 (ggactagtTATCTTCGGGAATGTCTGGCAAGTC), digested with SmaI/SpeI, and ligated into SmaI/SpeI-digested pAF65, resulting in pAF66. The SpeI/MluI fragment from pCSN44 containing the trpC promoter was ligated into SpeI/MluI-digested pAF66, resulting in pAF69.
The disruption constructs were digested (pAF68 with XhoI and pAF69 with KpnI), and the fragments containing the gene-hph-gene region were gel purified. The DNA fragments were transformed into N. crassa strain 87-74 (his-3 bd a) for pAF69 and strain 87-3 (bd a) for pAF68, following standard transformation protocols.
Quantitative real-time PCR analysis.
Total RNA was
prepared by the following procedure. Frozen mycelial samples were
powdered using a mortar and pestle at liquid nitrogen temperatures, and
100 mg of this powder was homogenized in 1 ml of Trizol (Gibco BRL) by
repeated pipetting. The extract was clarified by centrifugation at
4°C for 10 min at 12,000 x g, and 800
µl of the supernatant was mixed with 200 µl of
chloroform for
15 s. Samples were centrifuged at 12,000
x g for 15 min at 4°C. The top aqueous phase
(250 µl) was mixed with an equal volume of isopropyl alcohol
and incubated for 10 min at room temperature. The RNA was collected by
centrifugation for 10 min at 12,000 x g at
4°C. The pelleted RNA was washed with 1 ml of 75% ethanol, air
dried, and resuspended in 100 µl of RNase-free water. The RNA
concentration was determined by absorbance at 260 nm.
The RNA was treated with DNase I (Gibco-BRL) and used in a reverse-transcriptase reaction with random hexamers. Quantitative real-time PCR was performed with the generated cDNA, a pair of gene-specific primers, and SYBR Green reaction mixture (Applied Biosystems) using an ABI Prism 7700 Sequence Detection System (PE Biosystems) according to the manufacturer's instructions. The ribosomal L6 protein gene in Neurospora, which is not regulated by light or the circadian clock, was used for normalization (55). The gene-specific primer pairs were as follows: frq, 352F (TCGACATCGCAGAGGAGAAA)/417R (CAACGAAACCCCAGACGAGT); L6, L6R (GCGGATGGTCTTGCGG)/L6F (CAGAAATGGTACCCTGCTGAGG); al-2, al2-1 (CGACTCCGCATTGACCTGAT)/al2-2 (AGACCTCACGGCGAGATTTG); and con-6, con6-1 (TAATGTTTCCGAGGAAGCCA)/con6-2 (GGGTTCTTGTCGCCGTCGTC). Statistical differences between RNA transcript levels were tested by one-factor analysis of variance and a subsequent post hoc Dunnett's t test, where significance was set at a P value of <0.05.
Microarray analysis.
Mycelial tissue
was grown in liquid culture at 25°C for 10 h under
fluorescent lights, transferred to DD, and then transferred to R or FR
(
45 µmol photons/m2/s) for 0, 0.5, 2, or
24 h. The duration of growth in DD was varied so that all
cultures were grown for a total of 38 h. Two sets of
biologically independent samples were harvested. RNA preparation,
microarray preparation, hybridization, and scanning were done
essentially as previously described
(55). Each slide was
hybridized with two targets, one "experimental," which
was made from one of the R- or FR-treated samples, and one
"reference RNA," which consisted of a DD sample.
Experimental and reference RNAs were labeled with Cy3 and Cy5 dyes,
respectively, and the dyes were switched in one of the biologically
independent replicas of each sample. Data were analyzed using Gene
Traffic Duo (Iobion Informatics
LLC).
cDNA analysis.
RNA was extracted from strain 328-4,
which was exposed to a 30-min fluorescent-light pulse following
20 h growth in the dark. The RNA was DNase treated as
described for the real-time PCR analysis and used to generate cDNA by
reverse transcription with the Invitrogen Superscript Primary Strand
kit and the Oligo dT primer. The cDNA, together with the
following gene-specific primers, was subjected to
PCR: phy-1, ACF87
(gctctagaGATATCACGCAGCTTCCTAAACAACAC)/ACF123
(CCGGTTTAGGTTGCTCGCCATTTAC),
and phy-2, ACF85
(ggaattccTTCAAGTTACTAGCCCTATCACCAC)/ACF136
(ACTATTCCCATAAGCGAGCC).
The products were separated by gel electrophoresis; the correct-size
fragments were extracted from the gel and cloned into pCR4-TOPO
(Invitrogen TOPO TA cloning kit). Multiple clones for each gene were
then sequenced by standard methods and compared to the sequence data
generated by the Neurospora genome project
(http://www-genome.wi.mit.edu/annotation/fungi/neurospora/).
Other GenBank entries for phy-1 and phy-2, based on
predictions of intron/exon structure, differ from our empirically
generated cDNA analysis. Alignment of the putative PLD, GAF,
and PHY regions from a collection of representative Phys were performed
using CLUSTALX MAC v1.81
(http://www.embl.de/
chenna/clustal/darwin/)
and displayed using MACBOXSHADE v2.15 (Institute of Animal
Health, Pirbright, United
Kingdom).
PHY-1 antibody production and protein analysis.
The DNA sequence encoding the first
957 residues of PHY-1 was PCR amplified from the full-length cDNA clone
(see above) using primers designed to add an NdeI site proximal to the
start codon and a HindIII site immediately after codon 957. The product
was digested and inserted into pET24a (Novagen), and the resulting
C-terminally six-His-tagged expression construction was transformed
into BL21-Codon Plus-RIL cells (Stratagene). Transformed cells were
grown to logarithmic phase and induced with 1 mM IPTG
(isopropyl-ß-D-thiogalactopyranoside) for
4 h at 37°C. Following sonication of the cells, a
majority of the six-His-tagged PHY-1 polypeptide was in the inclusion
body fraction, necessitating the addition of 6 M urea for
solubilization. This soluble protein was purified by nickel chelate
affinity chromatography using Ni-NTA Superflow agarose (QIAGEN)
according to the manufacturer's directions. The eluate was dialyzed
against phosphate-buffered saline buffer (137 mM NaCl, 10 mM
KH2PO4, 100 mM Na2HP04, 27
mM KCl, pH 7.4) and used directly as the antigen for injection into
rabbits following standard procedures (Pocono Rabbit Farm and
Laboratory, Canadensis, PA). Neurospora protein extractions,
cellular fractionations, and immunoblot analyses were performed as
previously described
(22). Lambda protein
phosphatase (
PPase) (New England Biolabs) treatments were
performed at 30°C for 50 min on whole-protein extracts in which
the EDTA concentration in the extraction buffer was reduced from 5 mM
to 1 mM. Sodium vanadate was included to a final concentration of 20
mM.
Spectral analysis of PHY-2 (1-515). The region containing the chromophore-binding domain of PHY-2 (residues 1 to 515) was PCR amplified from reverse-transcribed mRNA from Neurospora mycelia using primers designed to add an NcoI site proximal to the start codon and a NotI site immediately after codon 515. The product was digested with NcoI and NotI and inserted into pET28b (Novagen), similarly digested, for expression in Escherichia coli with a C-terminal His6 tag. The PHY-2 (1-515) polypeptide was expressed in BL21 Codon Plus (DE3)-RIL cells as described previously (5) for 3 h following induction with IPTG. The crude soluble lysate was incubated for 50 min with either 13 µM biliverdin (BV) (Porphyrin Products, Logan, UT) or 10 µM phycocyanobilin (PCB) (provided by P. S. Song). The proteins were then purified from the soluble cell lysate by nickel chelate affinity chromatography (Novagen), and the buffer was exchanged for 70 mM Tris-HCl (pH 8.0)-1 mM Na4-EDTA by ultrafiltration with a Centriprep YM-10 column. Absorbance spectra were determined after saturating R (690-nm) and FR (775-nm) irradiations. Binding of bilins was assayed by zinc-induced fluorescence of the holoprotein following sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (5).
Nucleotide sequence accession numbers. The DNA and protein sequence information has been deposited at the National Center for Biotechnology Information, and the GenBank accession numbers are DQ128077 for phy-1 and DQ128076 for phy-2.
|
|
|---|
![]() View larger version (37K): [in a new window] |
FIG. 1. Domain
structure and amino acid sequence comparison of two Neurospora
phytochromes. (A) Domains and intron/exon structures of PHY-1
(left) and PHY-2 (right). The two splice variants detected for each Phy
are depicted directly below a schematic representation of the genomic
DNA of each locus. The thin black line at the top represents the
genomic locus, with letters indicating the relative positions of
restriction sites: B, BamHI; H, HindIII. The thicker lines indicate the
coding regions, with introns indicated by gaps. Conserved domains are
highlighted: light blue, PLD; dark blue, GAF domain; red, PHY domain;
green, HK domain; yellow, RR domain. The dashed lines indicate the
genomic regions deleted in the deletion strains. (B) Amino
acid sequence alignments of the PLD and the GAF and PHY domains of
PHY-1, PHY-2, several predicted fungal phytochromes (Fphs), and single
representatives of the BphPs, Cphs, and plant phytochromes. The
position of each domain in Phys is shown using PHY-2 and PHY-1 to help
locate the region in the Phy polypeptide. The top left alignment
compares the sequences surrounding the N-terminal PLD used by
Agrobacterium tumefaciens BphP1 to covalently bind bilins by a
cysteine thioether linkage. The cysteine is identified by the
arrowhead. The top right alignment shows the PHY domain. The bottom
alignment includes the region of the GAF domain that binds bilins via a
cysteine thioether linkage in Cphs and plant Phys or that may bind
bilins by a histidine Schiff base linkage in some BphPs. The cysteine
and histidine residues are identified by the open and closed
arrowheads, respectively. Black and gray boxes denote identical and
similar residues, respectively. Shown are Arabidopsis thaliana
(At), Aspergillus nidulans (An),
Botryotinia fuckeliana (Bf), Cochliobolus
heterostrophus (Ch), Deinococcus radiodurans
(Dr), Giggerella moniliformis (Gm),
Gibberella zeae (Gz), Synechocystis PCC6803
(Sy), and Ustilago maydis
(Um).
|
160 amino acids at the N terminus and an additional
200 amino acids separating the HK motif from the RR domain in
PHY-1. Alternative splicing of the phy-1 and phy-2 genes. Analysis of a population of phy-1 and phy-2 cDNAs detected alternatively spliced transcripts from both loci which could synthesize severely truncated polypeptides. The phy-1 alternative transcript contains an additional intron in the GAF domain, resulting in a frame shift that upon translation would synthesize a 591-amino-acid polypeptide encompassing the N-terminal 564 residues plus an additional 27 residues. This truncation, if expressed, would lack the majority of the GAF domain and the distal PHY, HK, and RR domains, strongly suggesting that it would not be photochemically active (Fig. 1A). The alternative transcript from phy-2 retains the third intron, located in the coding sequence for the PHY domain. If expressed, the resulting 684-amino-acid polypeptide, containing the N-terminal 670 residues plus an additional 14 residues encoded by an intron sequence, would have an intact GAF domain but would be missing part of the PHY domain and the entire HK and RR domains, suggesting that it could be photochemically active but incapable of signal transmission by itself (Fig. 1A). These alternative transcripts were detected from analysis of only a small collection of cDNAs (one out of eight phy-1 cDNAs and two out of four phy-2 cDNAs arising from the alternative spliced form), suggesting that they are relatively abundant and that more splice variants could be detected by more exhaustive cDNA analyses. While the function(s) of these alternative transcripts remains unknown, an intriguing possibility is that they express Phy variants with novel regulatory roles.
Assembly of PHY-2 apoprotein with bilins. To confirm that the PHY proteins indeed behave as typical Phys, we attempted to assemble the PHY-2 apoprotein with bilins and to examine the spectral behavior of the resulting chromoproteins. Unfortunately, the full-length version of PHY-2 expressed poorly in Escherichia coli, with nearly all of the protein found in the insoluble fraction. Truncations missing the C-terminal RR, HK, and PHY domains were equally insoluble. However, small amounts of soluble protein were obtained for a fragment encompassing just the N-terminal 515 residues. Because this region included the entire GAF domain necessary for autocatalytic attachment of the bilin and the PLD cysteine that likely provides the bilin attachment site, its use allowed us to test whether PHY-2 can bind bilins. As can be seen in Fig. 2, PHY-2 (1-515) readily bound both BV and PCB to form R/FR photochromic adducts. The characteristic Pfr absorbance was apparent upon BV binding, with a peak maximum of 693 nm (Fig. 2A). R irradiation converted this Pr to a "Pfr-like" state. While this Pfr form was substantially bleached relative to that obtained for full-length Phys, its absorption spectrum was reminiscent of those seen with similar truncations of bacterial and plant Phys missing the PHY domain (14, 31, 56). Consistent with the importance of the PHY domain in stabilizing the Pfr form (31), the BV adduct of PHY-2 (1-515) was unstable, as after photoconversion by R, Pfr rapidly cycled back to Pr by 100 min in the dark (Fig. 2C). The capacity to attach bilins covalently was confirmed by zinc-induced fluorescence of the chromophore following SDS-PAGE of the holoprotein. Incubation of Phy-2 (1-515) with either BV or PCB generated fluorescent adducts that were stable even following SDS denaturation (Fig. 2B).
![]() View larger version (23K): [in a new window] |
FIG. 2. Assembly
and spectral properties of a recombinant N-terminal fragment of PHY-2
containing amino acids 1 to 515. (A) Absorbance and
difference spectra of the PHY-2 (1-515) holoprotein assembled with BV
following saturating irradiations with R and FR. The absorbance maxima
of Pr are indicated. (B) Covalent binding of BV and PCB to
PHY-2 (1-515). Apo-PHY-2 (1-515) was incubated with or without
BV and PCB, purified by nickel-chelate affinity chromatography, and
then subjected to SDS-PAGE and either stained for protein with
Coomassie blue (top) or assayed for the bound bilin by zinc-induced
fluorescence (bottom). (C) Dark reversion of PHY-2 (1-515)
from Pfr to Pr. The holoprotein assembled with BV was photoconverted to
an equilibrium mixture containing Pfr and Pr and then incubated at
24°C in the dark. Reversion of Pfr to Pr was monitored by the
increase in absorbance at 693
nm.
|
Regulation of Neurospora phy-1 and phy-2 gene expression. In higher plants, the levels of some phy transcripts are regulated by changes in both the quantity and quality of light (15). Transcription of the Phys, cph1 and cph2, from the cyanobacterium Synechocystis PCC6803 is also down regulated by light, suggesting that similar regulation may occur in microorganisms (26, 57). To determine if the Neurospora phy genes are light regulated, quantitative real-time PCR analysis in which either the quantity or quality of light was varied was performed on RNA isolated from fungal mycelia. In one experiment, the wild-type strain was subjected to increasing doses of white light for 15 min to 24 h. (Similar treatments of Arabidopsis thaliana seedlings were previously shown to depress PHYA transcript levels [15]). Under these conditions, the levels of frequency (frq) mRNA, previously found to be rapidly induced by light (17), displayed a strong induction (F5,12 = 6.5; P = 0.0039) (Fig. 3A). However, for the phy-1 and phy-2 transcripts, there was no detectable change in mRNA abundance following any of the light treatments compared to an untreated control (T = 0 min) (phy-1 [F5,12 = 0.6; not significant] and phy-2 [F5,12 = 0.5; not significant]).
![]() View larger version (22K): [in a new window] |
FIG. 3. Light and circadian regulation of phy-1 and phy-2 transcripts and PHY-1 protein. (A) (Top) Quantitative real-time PCR analysis of phy-1, phy-2, and frq transcript levels following white-light treatments varying from 0 to 24 h. The error bars are the standard errors of the mean (SEM); n = 3. (Bottom) Western blot analysis of PHY-1 following white-light treatments varying from 0 to 24 h. The arrows highlight the two forms of PHY-1. The asterisks indicate nonspecific bands which cross-react with the PHY-1 antisera. The lower blot is shown as a loading control. (B) (Top) Quantitative real-time PCR analysis of phy-1 and phy-2 transcript levels in the dark (D) or following 12 h of R or FR treatment. phy-1 transcript levels were determined in wt and phy-2AF1 strains. phy-2 transcript levels were determined in wt and phy-1Af1 strains. The data were normalized to the lowest values for each transcript, which were set to 1. The absolute levels of phy-1 and phy-2 transcripts, therefore, cannot be directly compared. The error bars are the SEM; n = 3. (Bottom) Western blot analysis of PHY-1 in the dark or following 12 h of red- or far-red-light treatment in wt and phy-2AF1 strains. The arrows and asterisks are the same as in panel A. (C) (Top) Quantitative real-time PCR analysis of phy-1, phy-2, and frq transcript levels in constant darkness throughout 1.5 circadian cycles. The error bars are the SEM; n = 4. (Bottom) Western blot analysis of PHY-1 and FRQ in constant darkness over a 48-h period. The arrows and asterisks are the same as in panel A.
|
30 µmol
photons/m2/s) of monochromatic R and FR provided by
light-emitting diodes. (For Arabidopsis, as little as 0.3
µmol photons/m2/s of FR can induce significant
changes in PHYA mRNA levels after 24 h
[9]). In addition to a
wild-type strain, phy-1 transcript levels were monitored in a
phy-2AF1 strain and phy-2
transcript levels were monitored in a
phy-1AF1 strain. There was no difference
in phy-1 (F2,6 = 1.6; not
significant) or phy-2 (F2,6 =
0.17; not significant) transcript levels following the R or FR
treatments in the wild type (Fig.
3B, top), suggesting that
phy-1 and phy-2 transcripts are not regulated by R or
FR. Furthermore, we found no significant difference between the
transcript levels in the wt and phy deletion strains,
suggesting that the Neurospora PHYs are not
required for reciprocal transcriptional regulation. Whether each of the
PHYs autoregulates its own expression is not yet
known.
Under a 12-h light-12-h dark
photoperiod, all five Arabidopsis PHY
genes (PHYA to PHYE) display diurnal
patterns of expression, with transcript levels peaking during the light
period. After entrainment, these oscillations persist during continuous
light or dark, indicating that the expression of Arabidopsis
PHY genes is regulated by the circadian clock
(36,
70). To test for
circadian regulation of the phy-1 and phy-2
transcripts, mycelia of approximately the same developmental age were
harvested at 4-h intervals after transfer from light to DD (Fig.
3C). Through the action of
the blue-light-sensing WC-1 photoreceptor, the light-to-dark transfer
sets the clock to subjective dusk, after which the clock continues to
run in constant darkness (reviewed in reference
23). Under these
conditions, the circadian-clock-regulated frq transcript
displays a strong circadian rhythm, with mRNA levels reaching a peak
after
12 to 16 h in constant darkness
(F8,27 = 7.3; P = 0.0001)
(2). With regard to
phy-2, its transcript abundance fluctuated only slightly
without any apparent circadian regulation after the dark transfer
(F8,27 = 2.0; not significant). In
contrast, the phy-1 transcript appeared to be regulated in a
circadian fashion (F8,27 = 2.8; P
< 0.05), with transcript abundance gradually decreasing
following the light-to-dark transfer, reaching a low after 16 to
20 h in the dark and then rising to a peak at 24 to
28 h, corresponding to circadian time 15 to 19, or subjective
early evening (Fig. 3C).
The phy-1 transcript oscillated with an
2-fold
amplitude. phy-1 and phy-2 transcripts were not
examined under constant-light conditions.
The circadian oscillation and the lack of light regulation of the phy-1 transcript were confirmed by Northern blot analysis (data not shown). phy-1 mRNA ran slightly higher than the largest Neurospora rRNA species, indicating that the phy-1 transcript was at least 5 kb, in agreement with the cDNA analysis. We were unable to detect phy-2 transcript by Northern blotting, suggesting that the transcript is expressed at very low levels under the growth conditions used here.
PHY-1 is modified by phosphorylation.
To help detect the PHY-1 protein, we
generated antiserum against the N-terminal 957 residues of PHY-1. (We
also generated antiserum against the PHY-2 polypeptide but were unable
to detect PHY-2 in Neurospora extracts.) The specificity of
the antiserum was demonstrated by immunoblot analysis of extracts from
wild-type and phy-1AF1 strains (Fig.
3B, bottom). At the
approximate predicted molecular mass of PHY-1 (
168
kDa), two PHY-1 proteins were detected in wild-type extracts but were
absent in extracts from the phy-1AF1
strain (Fig. 3B). The
faster-migrating species was the more abundant form. The presence of
two species suggested that PHY-1 is posttranslationally modified, with
the slower-migrating species representing the modified form. To test
whether phosphorylation might be involved, we treated crude extracts
prior to SDS-PAGE with
PPase, a vanadate-sensitive phosphatase
that can remove phosphates bound to serine, threonine, tyrosine, and
histidine. The efficacy of this phosphatase treatment was confirmed
using the highly phosphorylated FRQ protein as a control
(25). As can be seen in
Fig.
4A,
FRQ migrates as a high-molecular-mass smear of species in untreated
crude extracts (lane1). However, upon
PPase treatment, a
lower-molecular-mass species (lane 2), whose formation can be
effectively blocked by pretreatment with vanadate (lane 3), becomes
predominant. When PHY-1 was examined following the same treatments, the
slower-migrating PHY-1 species (present between the faster-migrating
PHY-1 species and a slower-migrating nonspecific band detected with the
anti-PHY-1 antibodies) was no longer present, presumably having been
converted into the faster-migrating PHY-1 (lane 2). The conversion of
the slower-migrating form to the faster-migrating form was fully
inhibited by sodium vanadate, indicating that the change in mobility
was not due to the activities of contaminating proteases but was in
fact due to phosphorylation of PHY-1 (lane 3). PHY-1 therefore exists
in phosphorylated and unphosphorylated forms, with the latter being
severalfold more predominant.
![]() View larger version (50K): [in a new window] |
FIG. 4. PHY-1
is exclusively cytoplasmic and phosphorylated. (A) Western
blot of PHY-1 and FRQ from a dark-grown culture harvested after 20 h
and treated with PPase. Lane 1, untreated sample
revealing two PHY-1-specific bands (arrows) and a nonspecific band
(asterisk). Lane 2, sample treated with PPase, resulting in
the disappearance of the slower-migrating PHY-1 band. Lane 3, sample
treated with PPase and sodium vanadate (a specific inhibitor
of PPase) containing both forms of PHY-1, indicating that the
slower-migrating band is specifically due to phosphorylation. FRQ
served as a control for the PPase and sodium vanadate
treatments. (B) Western blot analysis of PHY-1 in cellular
fractions following light treatments indicates that both forms of PHY-1
are exclusively cytoplasmic, with light having no effect on
localization. A wt strain was treated with white light for durations
from 0 to 240 min; samples were harvested; and total, cytoplasmic, and
nuclear fractions were run on an SDS-PAGE gel and blotted for PHY-1
(indicated by arrows). A single time-zero sample for a
phy-1AF1 strain is shown on the left.
Equal amounts of protein were loaded for each time point, as indicated
by the similar intensities of the nonspecific band in each lane
(indicated by an asterisk). Proper fractionation was assayed by
immunoblotting with antibodies against WC-1, a predominately nuclear
protein (data not
shown).
|
In Arabidopsis, transfer of plants from a 12-h light-12-h dark photoperiod to continuous white light generates a very low-amplitude cycling of PhyA and PhyC, but no significant circadian cycling of PhyB and PhyE (PhyD has not been examined) (66). To look for a similar circadian regulation of PHY-1, mycelia of approximately the same developmental age were harvested at 4-h intervals over 48 h after a light-to-dark transfer. Western blot analysis revealed that neither PHY-1 abundance nor its phosphorylation is circadian-clock regulated (Fig. 3C, bottom). Although some fluctuations in the levels of both forms of PHY-1 were observed over the time course, these changes were not reproducible in replicate experiments. As a positive control, FRQ abundance and phosphorylation can be seen to be circadian-clock regulated, as previously reported (25).
Arabidopsis light-induced transcription is mediated at least partly by a direct interaction of PhyA and PhyB with transcription factors (48, 53, 54), an action that is made possible by the light-regulated import of these phytochrome molecules into the nucleus. To study the subcellular localization of PHY-1, we utilized a biochemical method to isolate nuclei from Neurospora and detect PHY-1 by Western blot analysis. Figure 4B shows the results of Western analysis of PHY-1 in total, cytoplasmic, and nuclear fractions for samples harvested from 0 to 240 min following light treatment. Both the nonphosphorylated and phosphorylated forms of PHY-1 were found exclusively in the cytoplasmic fraction in the dark and following the various durations of light treatment. Time of day also did not effect this PHY-1 localization, with both forms of PHY-1 always being localized to the cytoplasm (data not shown).
Phenotypic analysis of Neurospora phy-1AF1 and phy-2AF1 strains. Although Neurospora is a nonphototrophic organism, light regulates many of its developmental processes. During the asexual phase, light induces mycelial carotenoid biosynthesis (27); increases and hastens vegetative-spore production (or conidiation) (35, 39); and sets the phase of the endogenous biological clock, which acts to regulate a variety of aspects of the life cycle of the organism (reference 62; reviewed in reference 47). During the sexual phase, light influences the formation of protoperithecia (19) and the phototropism of perithecial beaks (28). All of these responses have been shown to be blue-light regulated and therefore are not considered to involve phytochromes, historically viewed as R/FR sensors. However, given that most action spectra failed to extend into the FR region of the spectrum, that phytochromes also absorb blue light (Fig. 2A), and that some blue-light responses in plants are modified by phytochromes (e.g., resetting the circadian clock [67], inhibition of hypocotyl elongation [74], and flowering time [49]), we reexamined the photobiology of Neurospora using the phy-1AF1 and phy-2AF1 strains.
To
determine if phy-1 or phy-2 plays a role in the
Neurospora circadian system, the correspondingdeletion strains were grown on race tubes using a high-light
(
30 µmol photons/m2/s)- or low-light
(
1 µmol photons/m2/s)-to-dark transfer to
entrain the cultures. (Both high and low light were tested based on the
observation in Arabidopsis that PhyA acts to transmit
low-fluence blue and red light to the clock and PhyB transmits
high-intensity red light to the clock
[67]). The period and
phase of the conidial banding were analyzed and compared in
phy-1AF1,
phy-2AF1, and two wt strains,
all progeny from the same cross. The
phy-1AF1 and
phy-2AF1 strains had phases
similar to those of the two wt strains (Fig.
5A and data not shown), suggesting that the phy genes do not play
a role in light input to the Neurospora clock. A light-induced
increase in frequency (frq) transcript levels is the
central mechanism by which light input reaches the clock. The light
induction of frq was also unaltered in a
phy-1AF1 or a
phy-2AF1 strain, further
supporting the lack of involvement of the phy genes in light
input to the Neurospora clock (Fig.
5D). The period lengths of
the phy-1AF1 and
phy-2AF1 strains following
the light-to-dark transfers are also similar to those of the wt
strains. Race tube experiments using a temperature step-up from
4°C to 25°C (in constant darkness) to entrain the
cultures also resulted in wt periods and phases for the
phy-1AF1 and
phy-2AF1 strains (data not
shown). Similarly, race tubes grown under R or FR showed no significant
changes in period length for the wt or the phy deletion
strains (data not shown). Taken together, it does not appear that PHY-1
or PHY-2 plays a central role in the Neurospora circadian
clock.
![]() View larger version (30K): [in a new window] |
FIG. 5. PHY-1
and PHY-2 do not play a role in previously described
Neurospora photobiology.
phy-1AF1 and
phy-2AF1 strains were assayed
for defects in developmental processes known to be light regulated (A,
B, and D) and for novel photobiology (C). (A) PHY-1 and PHY-2
do not play roles in light resetting of the Neurospora clock.
Race tubes were inoculated with wt,
phy-1AF1, or
phy-2AF1 strains, and the
clock was reset with a light-to-dark transfer. The period and phase of
conidial production in the
phy-1AF1 and
phy-2AF1 strains were similar
to those in the wt. Average periods and phases with standard errors of
the mean of six race tubes for each strain are shown, together with
representative race tubes. (B) PHY-1 and PHY-2 are not
required for phototropism of the perithecial beak. Protoperithecia were
induced in wt,
phy-1AF1/phy-2AF1,
and wc-1ER53 mutant strains
grown on petri plates. Duplicate plates for each strain were used in a
cross and then placed in the dark or in directional lighting. The
orientation of the resulting perithecial beaks (black, toward; white,
neutral; gray, away) was scored relative to the direction of the light
and plotted as a percentage of total perithecial beaks. L, light; D,
dark. (C) The linear growth rates of wt and
phy deletion strains are similar under various intensities of
red light. Total linear growth in 48 h under conditions of
constant red light was measured using race tubes. The error bars are
the standard deviations (SD); n = 3. (D)
Light induction of the frq, con-6, and al-2
transcripts is normal in
phy-1AF1 and
phy-2AF1 strains. RNA was
harvested from wt, phy-1AF1,
and phy-2AF1 strains grown in
constant darkness or following 15 min, 30 min, or 24 h of
light treatment. The transcript levels of frq (light induced
to reset the clock), al-2 (light-induced carotenogenesis
gene), and con-6 (light-induced conidiation gene) were
determined using quantitative real-time PCR. The data are plotted with
the zero-min values for each strain set to 1 so that the y
axis indicates induction (n-fold) for each strain. The error
bars are the SD; n =
3.
|
Transfer of Neurospora cultures from the dark into the light triggers an increase in conidial production requiring the light induction of several conidiation, or con, genes (40, 41). We detected no gross defects in conidial production in phy-1AF1 and phy-2AF1 strains or in a strain containing both phy deletions (data not shown). On the molecular level, we also found no differences in the light induction of con-6 and con-10 genes in the phy deletion strains (Fig. 5D and data not shown). These results suggest that the phy genes do not play a role in the enhancement of conidiation by light. A dark-to-light transfer also stimulates carotenoid production in the mycelia, resulting in a very obvious increase in orange coloration. This carotenogenesis requires the light induction of the carotenoid biosynthesis genes albino-1 (al-1), albino-2 (al-2), and albino-3 (al-3) (3, 43). Both light-induced carotenoid production and the abundance of the al-1 and al-2 transcripts in the phy-1AF1 and phy-2AF1 single and double mutants were indistinguishable from those of the wt (Fig. 5D and data not shown).
PHY-1 and PHY-2 are primarily predicted to function as sensors of R and FR, wavelengths for which no photobiological responses have been found in Neurospora. We therefore looked for novel photobiology, potentially R/FR regulated, which might require the activity of the phy genes. We first looked for gross effects of R/FR on Neurospora growth. Race tubes were inoculated and grown for 48 h under cool fluorescent lights; the growth fronts were marked and then transferred to continuous R or FR. After a subsequent 48 h of growth, the race tubes were removed and the linear growth of the cultures was measured. Although a slight decrease in growth with increasing light intensity is seen for all strains, we found no significant difference in the linear growth rate between wt, phy-1AF1, phy-2AF1, and phy-1AF1/phy-2AF1 strains under conditions of constant R or FR of various intensities (0.25 to 160 µmol/photons/m2/s) (Fig. 5C). There were also no gross morphological differences between the phy deletion strains and the wt under the conditions tested. Similar experiments were also performed using blue light with no difference found between the phy deletion strains and the wt (data not shown).
Although no appreciable difference in growth under constant R or FR illumination was detected in the phy knockout strains, it was possible that Neurospora could exhibit phototropism during the asexual stage of its life cycle. To assay for phototropism, Neurospora was cultured using numerous different physical setups combined with various directional-lighting configurations using standard fluorescent lighting, as well as custom-fabricated light-emitting diode arrays (blue, red, and white). Using standard race tubes, cultures were inoculated at one end and then placed in chambers with a light source at one or both ends of the chamber. Both the light source and the intensity were varied, enabling the testing of a variety of lighting configurations (e.g., low-intensity red light at one end of the chamber or high-intensity red at one end and low-intensity blue at the other). Modified race tubes that enabled inoculation in the middle of the tubes, as well as 150-mm petri plates, were also used in the chambers described above. We also developed a novel means of looking for effects of light on the fine branching structure of mycelia, using thin (1-mm) vertical gels similar to those used to run protein samples. Standard solid growth medium was poured between two glass plates, and Neurospora was inoculated at the top. The plates were positioned and masked so that light would reach the culture only from above or below. We could subsequently look for directional growth or effects on the mycelial branching pattern using a dissecting microscope. Stationary liquid cultures were also employed with a variety of lighting configurations. We failed to uncover any conditions or setup under which Neurospora displayed reproducible phototropism in wt strains or in the phy deletion strains (data not shown). We also considered the possibility that the PHYs might not be involved in light sensing per se but instead in heme and/or iron metabolism, so single and double phy mutant strains were cultured on race tubes with limited and different sources of iron; in no case was a significant difference in growth rate or gross morphology detected.
To complement the
overt R/FR phenotypic analyses of wt and phy deletion strains,
we used available Neurospora DNA microarrays to look at the
molecular level for potential R/FR gene regulation that could be
attributed to the Neurospora Phys. Mycelial tissue from a wt
strain was collected from liquid cultures receiving R or FR treatment
for 0, 0.5, 2, or 24 h. The arrays contained
1,100
unique cDNA clones (described in reference
55) representing
approximately 10% of the total predicted genes in the
Neurospora genome. Using two biologically independent sets of
samples, we did not see any reproducible and verifiable changes in gene
expression due to any of the R or FR treatments (data not shown). The
genes on the arrays were identified by expressed sequence tag
sequencing of libraries made from nondifferentiating vegetative tissue
grown in the dark, with the result that light-induced genes were
predicted to be severely underrepresented on the arrays. It is
therefore possible that the use of arrays containing a larger set of
genes might uncover R/FR regulation in
Neurospora.
|
|
|---|
All five of the domains (the PLD and the GAF and PHY domains, followed by the HK and RR domains) identified in PHY-1 and PHY-2 are present in Phy sequences from the filamentuous fungi Aspergillus nidulans, Botryotinia fuckeliana, Cochliobolus heterostrophus, Giggerella moniliformis, Gibberella zeae, and Ustilago maydis (10, 72), suggesting that these domains are important to this Phy subfamily. Some of these other fungal Phys also contain regions with limited similarity to the additional sequences found in PHY-1. Interestingly, Phys have been conclusively found only in filamentous fungi and are not evident in the genomes of single-cell fungi, such as Saccharomyces cerevisiae and Schizosaccharomyces pombe (72), suggesting roles for the Phys in regulating the greater developmental complexity of the filamentous morphology.
The N-terminal halves of PHY-1 and PHY-2,
consisting of the PLD and the GAF and PHY domains, are predicted to
function as the light sensory input module. Like Phys from eubacteria,
PHY-1 and PHY-2 do not contain the positionally conserved cysteine in
the GAF domain used by plant and various cyanobacterial Phys to
covalently bind the bilin via a thiol-ether linkage (reviewed in
reference 72). Like other
fungal Phys, a small hydrophobic residue (Val/Ile) is in this position
(Fig. 1B). From a limited
study of bacterial Phys, it appears that a cysteine within the PLD
serves as the bilin attachment site in this subgroup
(31,
37,
38). Similar to all other
identified fungal Phy sequences, PHY-1 and PHY-2 contain this conserved
cysteine (Fig. 1B). A
515-amino-acid recombinant fragment of PHY-2 containing just the PLD
and the GAF domain was able to covalently attach both BV and PCB to
form R/FR photochromic adducts. These results confirm that PHY-2 and,
most probably, PHY-1 are capable of autocatalytically attaching bilins
and functioning as typical Phy photoreceptors. The
BV-PHY-2 Pr absorption maximum
(
693 nm) was slightly red shifted compared to
those of plant Phys (
666 nm) and cyanobacterial phytochromes
(Cphs) (
654 nm) but similar to
BV-bacteriophytochromes (BphPs) (
698 nm). The
P
B/PCB precursor BV is used by BphPs as the chromophore, and
it is likely that PHY-1 and PHY-2 also use BV as the natural
chromophore, based on their similarity to bacteriophytochromes.
However, BLAST searches of the Neurospora genome have so far
failed to uncover a possible heme oxygenase that is required to
generate BV from heme.
The C-terminal halves of PHY-1 and PHY-2, containing the HK and RR domains, appear to be hybrid TC-histidine kinase sensory output modules. Originally identified in bacteria, TC-HK phosphorelays are minimally composed of a sensor HK protein and a separate RR protein that helps many organisms sense and adapt to their environments. The appropriate environmental signal (e.g., nutrient levels, osmolarity, light, or oxygen levels) triggers the autophosphorylation of a conserved histidine residue by the HK domain in an ATP-dependent manner. The phosphoryl group is then transferred to a conserved aspartate residue in the RR, with this differential phosphorylation directing an appropriate output, such as a change in transcription, motility, or signaling, through a kinase cascade (reviewed in reference 61). The HK domains of PHY-1 and PHY-2 contain the conserved H box, including the positional conserved histidine that is the site of autophosphorylation, and the N and G boxes that participate in ATP binding (Fig. 1B). The phosphorylated form of PHY-1 could represent a more long-lived autophosphorylated species generated by this reaction sequence. The presence of the appended RR likely means that the histidine phosphate is transferred intramolecularly to the RR aspartate, rather than to a second separate RR polypeptide during signal transmission.
The absence of an output domain following the RR implies that additional phosphorelay steps are required before signal output by both PHY-1 and PHY-2. In similarly organized TC-HK systems, the RR aspartate-bound phosphate is transferred to the histidine of a separate histidine phosphotransferase (HPT) protein, and then ultimately, the phosphate is transferred to an aspartate in a second RR protein (reviewed in reference 61). The roles of these additional phosphorelay steps are unknown, but it has been speculated that this design enables integration of multiple input signals to a single output. Neurospora is predicted to contain nine additional hybrid HKs that could sense a variety of environmental signals (8, 10). One of these HKs, Nik-1/Os-1 (NCU02815.1), plays a role in hyphal development and may be involved in sensing osmolarity (1, 64). Neurospora is predicted to express only one HPT protein (NCU01489.1) and two RRs (NCU01895.1 and NCU02413.1). This small number suggests that the 11 hybrid HKs in Neurospora converge to activate only a few common pathways. Therefore, it is possible that the R/FR signaling by PHY-1 and PHY-2 are integrated with other HK signaling systems. The possibility that more than one signal is required before output could explain why we have so far failed to uncover any responses under PHY-1 or PHY-2 control using just R/FR as the signal.
The analysis of transcript regulation indicates that both Neurospora phy genes are expressed, with Northern analysis suggesting relatively low expression of phy-2. In Arabidopsis, transcription of PHYA, and to a lesser extent PHYB, is under negative control by light, with the accumulation of mRNA inversely related to the fluence rate (9, 15). R reduces PHYA transcript levels through the action of the PhyB protein, whereas FR reduces PHYA transcript levels through the action of the PhyA protein itself (9). We did not find changes in either light quality or quantity to have an effect on the levels of Neurospora phy-1 or phy-2 transcript. As such, the Neurospora PHYs are similar to Arabidopsis PHYC, PHYD, and PHYE, which display little or no photoregulation. At the protein level, light also causes a dramatic decrease in Arabidopsis PhyA protein and, to a much lesser extent, PhyB and PhyC (66, 68). However, similar to Arabidopsis PhyD and PhyE, we found no effect of light on PHY-1 protein levels. phy-1, but not phy-2, transcript exhibited a low-amplitude circadian rhythm under constant conditions. In contrast, PHY-1 protein levels lacked circadian regulation, consistent with the protein being quite stable compared to the 24-h time scale of the phy-1 RNA rhythm. Interestingly, this type of regulation, circadian transcription but constitutive protein abundance, has also been seen for Arabidopsis PhyB and PhyC.
We found that neither light nor time of day alters PHY-1
cytoplasmic localization. In contrast, Arabidopsis PhyA and
PhyB translocate to the nucleus following white-light treatment, with
PhyA nuclear levels peaking within 10 min and PhyB requiring
6 h for maximal translocation
(32-34,
60,
63,
76). The lack of
light-regulated shuttling of PHY-1 into the nucleus, as well as the
complete lack of PHY-1 in the nucleus, may be reasonable, considering
the domain structure and potential signaling mechanism of PHY-1. As
mentioned above, PHY-1 is a hybrid histidine kinase containing both a
histidine kinase domain and a receiver domain within a single
polypeptide. One of the most intensively studied hybrid histidine
kinases, S. cerevisiae's Sln1, is localized to the plasma
membrane, where it detects osmotic stress to the cell. One of Sln1's
downstream signaling partners is Skn7, which is a nucleus-localized
transcription factor. Signaling between Sln1 in the plasma membrane and
Skn7 in the nucleus is speculated to be mediated by the shuttling of
the HPT protein Ypd1, which is small enough (
20 kDa) to freely
diffuse into the nucleus (reviewed in reference
61). In an analogous
fashion, PHY-1 and PHY-2, along with the 11 other hybrid histidine
kinases, could be localized to the cytoplasm or plasma membrane, with a
single HPT shuttling to nucleus-bound response regulator
proteins.
Although the expression, regulation, and in vitro
photochemistry of Neurospora PHY-1 and PHY-2 strongly suggest
that they have a photobiological role in Neurospora, we have
failed to identify specific processes under their control. Much of
Neurospora photobiology is regulated by blue light in a
WC-1/WC-2-dependent manner. However, it remains possible that some are
also sensitive to R and/or FR, as is the case for many photoresponses
in plants that involve multiple photoreceptors with overlapping
functions (12). In the
filamentous fungus Aspergillus nidulans, conidiation is
elicited by exposure to red light in the range of 690 to 710 nm
(51), with the same
wavelengths also causing a delay in sexual sporulation
(11). More recently, a
role for red light, mediated by a phytochrome, was seen in blocking
sexual development in Aspergillus
(7a). Interestingly, blue
light (maximum,
463 nm) has also been found to have the same
effects on conidiation and sexual sporulation, but only in a strain
with a mutation in the bliA1 gene
(11,
75). This suggests that
blue-light regulation does exist in Aspergillus but that it is
inhibited under standard laboratory conditions by a
bliA1-dependent mechanism. A similar situation may exist in
Neurospora, with blue-light regulation readily apparent but
red/far-red signaling inhibited under laboratory conditions. This is
supported by the fact that the known Neurospora
photobiological processes are strongly regulated by many additional
environmental factors, such as desiccation, gas concentrations, and
available nutrients (e.g., conidiation is greatly increased by small
increases in the amount of available carbon and inhibited by small
increases in CO2 levels.). R/FR regulation of
Neurospora's various developmental processes may occur only
under specific conditions when inhibition of PHY signaling (potentially
by some of the other nine HK proteins) is prevented. Systematically
varying growth conditions may enable the empirical determination of
conditions under which R/FR light perceived by the Neurospora
phytochromes is translated into appropriate regulation of developmental
processes, such as conidiation and carotenogenesis.
This work was supported by grants from the NIH (R37 GM34985 to J.C.D. and MH44651 to J.C.D. and J.L.) and NSF grants MCB-0084509 to J.L. and MCB 0424062 to R.D.V.
Present address: Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139. ![]()
Present
address: Plant Metabolism Research Center, Kyung Hee University, Suwon
449-701, Korea. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»