| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Gyanendra Tripathi,
Gwyneth Bertram,
Susan Macaskill,
Abigail Mavor,
Louise Walker,
Frank C. Odds,
Neil A. R. Gow, and
Alistair J. P. Brown*
Aberdeen Fungal Group, School of Medical Sciences, University of Aberdeen, Institute of Medical Sciences, Foresterhill, Aberdeen AB25 2ZD, United Kingdom
Received 10 May 2005/ Accepted 13 July 2005
| ABSTRACT |
|---|
|
|
|---|
kinase, like its S. cerevisiae homologue. However, GCN4 appears to be regulated mainly at the transcriptional level in C. albicans. Furthermore, the inactivation of C. albicans Gcn2 only partially attenuates growth under amino acid starvation conditions and resistance to the histidine analogue 3-aminotriazole. Our comparison of the Gcn4 and Gcn2 regulons by transcript profiling reinforces the view that Gcn2 contributes to, but is not essential for, the activation of general amino acid control in C. albicans. | INTRODUCTION |
|---|
|
|
|---|
The GCN response (or general amino acid control) is characterized by the induction of genes in most amino acid biosynthetic pathways in response to starvation for even a single amino acid. This response has been shown to exist in C. albicans and to be involved in both morphogenesis and biofilm formation (19, 46, 49). Furthermore, this response depends on the transcription factor Gcn4 (46), which is characteristic of fungal GCN-like responses (25, 27, 48).
GCN signaling has been best characterized in Saccharomyces cerevisiae (reviewed in references 25 and 26). In budding yeast, amino acid starvation leads to the intracellular accumulation of uncharged tRNAs, which interact with the regulatory histidyl-tRNA synthetase-like domain of Gcn2, thereby stimulating its eukaryotic initiation factor 2
(eIF2
) kinase activity. Phosphorylation of eIF2
at serine-51 by Gcn2 inhibits guanine nucleotide exchange on eIF2, thereby decreasing the activity of this essential translation initiation factor. In this way, Gcn2 causes the global rate of mRNA translation to decrease in response to amino acid deprivation. However, in parallel, the decrease in eIF2 activity enhances translation of the GCN4 mRNA. This translational control is mediated by the unusually long 5'-leader sequence on the GCN4 mRNA, which carries four upstream open reading frames (ORFs). Essentially, these upstream ORFs repress translation of the main GCN4 ORF, and this repression is alleviated by Gcn2-mediated phosphorylation of eIF2
during amino acid starvation. As a result, Gcn4 levels increase, thereby leading to the transcriptional activation of amino acid biosynthetic genes via Gcn4 response elements (GCRE) (TGACTC) in their promoters (25, 37). In S. cerevisiae, GCN4 transcription increases about twofold in response to amino acid starvation (2), but Gcn4 synthesis is regulated primarily at the translational level (26). Hence, in S. cerevisiae, the GCN response is blocked by mutations that inactivate Gcn2 or Gcn4.
By analogy with S. cerevisiae, we reasoned that Gcn2 might be important for the GCN response in C. albicans. In this study we show that while Gcn2 does contribute to the GCN response in C. albicans, it plays a nonessential role. Instead, GCN4 appears to be regulated primarily at the transcriptional level in C. albicans.
| MATERIALS AND METHODS |
|---|
|
|
|---|
|
GCN4-GFP and gcn4-GFP fusions were constructed at the GCN4 locus with the GFP-URA3 cassette as described previously (20). For the GCN4-GFP fusion, the primers used were 5'-GAAAAGCAAGCTTTACAAGATCAAGTTGAA AGATTACAAGAATTGTTAAGAGTTAATGGTATTCAATTTGGTGGT GGTTCTAAAGGTGAAGAATTATT and 5'-TAAAAAAACAATAATAAT TTTCTAAATTTTTCTTTTTTTAAAAAAATAACGAGAGGTATATAT AGTAGTTCTAGAAGGACCACCTTTGATTG (R1-GCN4). To create the gcn4-GFP fusion, which disrupted the GCN4 locus, primer 5'-GATTTATTT GCTTCTCCAGTTAAACAACAACATCAAAAGGTTGATACTGTTGCT ACCAAAAACGAAATTGGTGGTGGTTCTAAAGGTGAAGAATTATT was used with the R1-GCN4 primer.
To create pGCN4GCRE-GFP, the wild type GCN4 5' region (996 to +1) was PCR amplified with primers 5'-CTCTAAAGACTCGAGAAATAGCGAAAA TGTAAATATAAATTTATGAGTCATAATTTCTCTCG and 5'-AGTAGC AAGCTTTTTATCTAATAATAATAATGGTAACAAAGCTAATTAATG TAATGTAATTTAATTTAAATAGC (XhoI and HindIII sites underlined; GCRE in italics). To generate pGCN4-GFP, the GCN4 allele (996 to +1) was amplified from the GCN4 allele lacking the GCRE at 582 (TTATTAA) with the forward primer 5'-CTCTAAAGACTCGAGAAATAGCGAAAATGTAAATATAAATTTATAATGTATAATTTCTCTCG (XhoI site underlined; mutated GCRE at 968 in italics) and the same reverse primer. This product lacked both GCRE at 968 and 582. Both the wild-type and mutant sequences were cloned between the XhoI and HindIII sites in pGFP (3) and resequenced to generate pGCN4GCRE-GFP and pGCN4-GFP, respectively. These plasmids were integrated at the RPS1 locus (34). (The RP10/RPS10 gene has been renamed RPS1.)
Renilla reniformis LUC (RrLUC) promoter fusions were made in a plasmid containing a basal C. albicans ADH1 promoter upstream of the RrLUC reporter (46). The GCRE-RrLUC fusion was made by inserting the sequence 5'-CTG ACTCTGAGGTGACTCGGATCCTGACTCTACTGTGACTCTATAGTG ACTCT (GCRE underlined) between the BstEII and SpeI sites of this basal construct. RrLUC plasmids were linearized with HindIII and transformed into C. albicans. Single-copy integration at the ade2 locus was confirmed by PCR and Southern blotting.
Blotting and RT-PCR. Southern (35), Northern (9), and Western (12) blotting were performed as described previously. The rabbit anti-phospho-eIF2(pSer51) antibody was from Sigma (St Louis, MO). Reverse transcription-PCR (RT-PCR) was performed by standard methods (44) with the following green fluorescent protein (GFP) primers: 5'-CACTGGTGTTGTCCC and 5'-CCATACCAT GGGTAA (677-bp product). The intron-containing EFB1 product was used to control for loading and genomic DNA contamination (44).
Reporter assays. GFP fluorescence was visualized by microscopic analysis as described previously (3). Renilla luciferase activities (105 relative light units/20 µg protein) were measured in quadruplicate (35) in C. albicans transformants after 3 h of growth at 30°C in SC lacking histidine and containing 40 mM 3AT. Similar data were obtained in three experiments done with independent transformants.
Transcript profiling. Transcript profiling was performed on the congenic C. albicans strains CAF2-1, GTC43, HTC43, HTC47, and HTC51 growing in SC lacking histidine after 3 h of exposure to 0 or 40 mM 3AT. Transcript profiling was performed as described previously (16, 36). Briefly, total RNA was isolated (24), Cy3- and Cy5-labeled cDNAs were prepared, and these probes were hybridized with C. albicans microarrays (Eurogentec, Seraing, Belgium). Slides were scanned at 10-µm resolution with a ScanArray Lite scanner (Perkin-Elmer Life Sciences, Beaconsfield, United Kingdom) and quantified with QuantArray software (version 2.0). GeneSpring software (Silicon Genetics, Redwood City, CA) was used for data normalization and analysis, and statistical analysis was performed with SAM (significance analysis of microarrays) (47). Data from at least three independent biological replicates were used for each analysis, and the SAM false-discovery rate was set at 10%. Expression ratios for each gene that displayed a reproducible and statistically significant change in expression are available at the Galar Fungail websites (http://www.pasteur.fr/recherche/unites /Galar_Fungail/ and http://www.galarfungail.org/data.htm). C. albicans gene annotations were obtained from CandidaDB (http://genolist.pasteur.fr/CandidaDB) (14). Functional categories for C. albicans genes were assigned mainly on the basis of the MIPS functional assignments for S. cerevisiae homologues (http://mips.gsf.de/proj/yeast/CYGD/db/index.html) (49).
| RESULTS |
|---|
|
|
|---|
kinase.
Our initial working hypothesis was that regulation of the GCN response in C. albicans would closely mirror the S. cerevisiae GCN control mechanisms that have been defined in some detail by numerous groups over many years (reviewed in references 25 and 26). As described above, Gcn2 plays a critical role in control of the GCN response in S. cerevisiae. Therefore, we screened the C. albicans genome sequence for GCN2-like loci. Only one C. albicans ORF (GCN2; orf19.6913) encodes a protein with significant sequence similarity to S. cerevisiae Gcn2 (37% identity). The C. albicans Gcn2 protein sequence contains partial kinase-, eIF2
kinase-, and histidyl-tRNA synthetase-like domains. It also displays significant sequence similarity to GCN2 eIF2
kinases from mammals, flies, and plants (Fig. 1A).
|
kinase activity in C. albicans is dependent on Gcn2, we generated homozygous gcn2/gcn2 null mutants. Essentially, the two GCN2 alleles in this diploid fungus were disrupted sequentially, removing codons 167 to 1589 of the 1,764-codon ORF to create three independent homozygous mutants in two C. albicans strains (CAI-4 and CAI-8), thereby generating a total of six gcn2/gcn2 null mutants (Table 1). The eIF2
kinase activities in mutant and wild-type cells were compared by Western blotting with an antibody specific for the phosphorylated form of eIF2
(Fig. 1B). No detectable eIF2
kinase activity remained in the mutant cells, indicating that GCN2 encodes the major eIF2
kinase activity in this fungus.
The eIF2
kinase activity increased in wild-type cells following exposure to 3AT (Fig. 1B), suggesting that Gcn2 is activated in response to amino acid starvation. This is consistent with the idea that Gcn2 plays a role in the C. albicans GCN response.
GCN2 inactivation reduces the tolerance of C. albicans to 3AT. We tested whether the ability of C. albicans to respond to amino acid starvation depends on GCN2. Resistance to the histidine analogue 3AT is a classic indicator of the GCN response in S. cerevisiae and C. albicans (25, 46). Therefore, we compared the 3AT sensitivity of gcn2 cells with that of wild-type and gcn4 controls (Fig. 2A). Inactivation of GCN2 only partially attenuated the resistance of C. albicans to 3AT: gcn2 cells grew slowly on solid medium containing 10 mM 3AT. In contrast, S. cerevisiae gcn2 cells were sensitive to 5 mM 3AT. The same phenotype was observed for all six independent gcn2-null mutants (HTC44, HTC48, HTC52, HTC84, HTC88, and HTC92 [Table 1]). Therefore, C. albicans is less dependent on Gcn2 for growth in the presence of this toxic histidine analogue than S. cerevisiae. However, both yeasts require Gcn4 for 3AT resistance (Fig. 2).
|
Amino acid starvation stimulates morphogenesis in C. albicans but not in S. cerevisiae (46). Hence, C. albicans forms wrinkly colonies in the presence of 3AT. Interestingly, gcn2 cells also formed wrinkly colonies (Fig. 2A), indicating that Gcn2 is not required for the morphogenetic response of C. albicans to amino acid starvation.
Transcriptional activation via the GCRE is not dependent on Gcn2. The GCN response in C. albicans is mediated by Gcn4, which activates the transcription of genes via the GCRE (46). Hence we reasoned that if Gcn2 plays a relatively minor role in this GCN response, the expression of a GCRE reporter gene in C. albicans should not depend on GCN2. To test this, the activities of basal and GCRE-containing luciferase reporters were measured in wild-type, gcn4, and gcn2 cells following exposure to 3AT. The GCRE reporter contained five copies of the GCRE upstream of a control basal reporter with the TATA box and RNA start site from the C. albicans ADH1 promoter. The expression of the control basal reporter was not affected by the disruption of Gcn2 or Gcn4. Also, the activation of the GCRE reporter was inhibited in gcn4 cells (Fig. 3), as expected (46). As predicted, inactivation of Gcn2 had no significant effect on this GCRE reporter. These data confirm that the GCRE mediates the transcriptional activation of C. albicans genes by Gcn4, and they suggest that Gcn2 does not contribute significantly to this activation.
|
The first GCN4-GFP fusion contained the wild-type 5' region (from 996 to +1) cloned upstream of the synthetic, codon-optimized yEGFP gene (12) in pGCN4GCRE-GFP. We noticed that the region upstream of the main GCN4 ORF contained two GCRE at 968 and 582 with respect to the start codon. Therefore, we made a second GCN4-GFP fusion, which lacked these putative GCREs, to test whether they are required for the transcriptional activation of GCN4. This second fusion was called pGCN4-GFP. The two fusions were integrated at the RPS1 locus, and the responses of the two fusions to 3AT were examined by Northern blotting and fluorescence microscopy (Fig. 4).
|
Transcriptional activation via the GCRE in C. albicans is known to be mediated by Gcn4 (46). Therefore, we tested whether Gcn4 is required for transcriptional induction of GCN4. To achieve this, we integrated GFP at the chromosomal GCN4 locus in wild-type CAI-4 cells and a heterozygous GCN4/gcn4 mutant, GTC42 (Table 1). To generate a functional fusion, the GFP ORF was fused in frame after the last codon of the GCN4 allele (strains HTC101 and HTC103). To generate a nonfunctional fusion, GFP was inserted in frame after codon 40 of GCN4 (strains HTC102 and HTC104). Strains HTC101 and HTC102 retained one wild-type GCN4 allele, whereas strains HTC103 and HTC104 carried an inactive gcn4 allele in addition to their GFP fusion (Table 1). To test the Gcn4 functionality of the GCN4-GFP and gcn4-GFP fusions, we examined the 3AT resistance of strains HTC103 and HTC104 (Fig. 5A). HTC103 was 3AT resistant, indicating that the GCN4-GFP fusion retained Gcn4 functionality. In contrast, HTC104 was 3AT sensitive, indicating that the gcn4-GFP fusion did not retain Gcn4 functionality, as predicted.
|
In light of this result, we examined the behavior of pGCN4GCRE-GFP in gcn4 cells. Northern blot analysis revealed that the GFP mRNA levels from this construct increased in gcn4 cells in response to 3AT, even though these cells did not express a functional Gcn4 (not shown). This was consistent with the above findings.
Taken together, our data suggest that C. albicans GCN4 is transcriptionally activated in response to 3AT and that GCRE contribute to this transcriptional activation, but that Gcn4 is not required for this transcriptional activation.
Definition of Gcn4 and Gcn2 regulons in C. albicans. Our data suggested that Gcn2 plays a relatively minor role in the GCN response in C. albicans, whereas Gcn4 plays a major role in this response. To test this further, we examined the Gcn2 and Gcn4 regulons in C. albicans by transcript profiling. To our knowledge, this is the first time that the Gcn2 regulon has been studied in any fungus. The transcript profiles of wild-type, gcn2, and gcn4 cells were compared following exposure to 0 or 40 mM 3AT. Only reproducible and statistically significant changes observed in three independent experiments are discussed.
The transcript profiling data were consistent with our analysis of the Gcn4 proteome in C. albicans (49) and with previous Northern blot analyses of GCN-responsive mRNAs (ARO4, HIS4, HIS7, LYS2, and GCN4 [46]). Furthermore, the data revealed strong similarities between the Gcn4 transcriptomes of C. albicans and S. cerevisiae (37). For example, exposure to 3AT affected the expression of a relatively large proportion of C. albicans genes (about 13% of the ca. 6,200 ORFs). About half of these genes were induced, and half were repressed (Fig. 6A). For most genes (91%), this regulation was lost in gcn4 cells, indicating that Gcn4 is required for most transcriptional responses to 3AT. Furthermore, amino acid biosynthetic functions were significantly enriched among those genes that were induced by 3AT in a Gcn4-dependent fashion (Table 2). Genes in all amino acid biosynthetic pathways were induced by 3AT in a Gcn4-dependent fashion, and HIS1, HIS3, HIS4, HIS5, and HIS7 mRNAs were all induced more than threefold. These findings were entirely consistent with the observation that Gcn4 is essential for responses to amino acid starvation (Fig. 2) (46).
|
|
There was significant overlap between the Gcn2 and Gcn4 regulons in C. albicans. About half of the 328 genes that were induced by 3AT in a Gcn4-dependent fashion were not induced in gcn2 cells (Fig. 6A, gray sector of Venn diagram). This indicates that the induction of these 168 genes was also Gcn2 dependent. The extent of the overlap between the regulons was even greater for 3AT-repressed genes. Genes involved in protein fate, cell rescue, defense, and virulence were significantly enriched in the subset of genes that were induced in a Gcn4- and Gcn2-dependent fashion.
Only seven mRNAs were induced by 3AT in wild-type and gcn4 cells but not in gcn2 cells (Fig. 6A). This indicated that almost all genes whose expression was induced by 3AT were dependent on Gcn4 for this induction. In contrast, 160 mRNAs were induced by 3AT in wild-type and gcn2 cells but not in gcn4 cells (Fig. 6A, black sector of the Venn diagram). The activation of these mRNAs appears to be dependent on Gcn4 but independent of Gcn2. Genes involved in transport facilitation were significantly enriched in this subset. However, it was possible that their activation was partially dependent on Gcn2. According to this scenario, the inactivation of Gcn2 would reduce, but not block, the induction of these mRNAs.
To test this, we analyzed the responses of C. albicans genes to 3AT in more depth. We performed K-means clustering to separate genes on the basis of their expression patterns in wild-type, gcn2, and gcn4 cells. C. albicans genes fell into four main K-means subsets. We then examined the behavior of the amino acid biosynthetic genes in these subsets (Fig. 6B). A small proportion of amino acid biosynthetic genes did not respond to 3AT (set 1). However, most amino acid biosynthetic genes did respond to 3AT. Some of these remained relatively unaffected in gcn2 cells (set 2), whereas the 3AT response of others was blocked by the inactivation of Gcn2 (set 4). Most amino acid biosynthetic genes fell into set 3, although this set contained the smallest number of C. albicans genes. Genes in set 3 responded to 3AT in wild-type cells; this response was all but lost in gcn4 cells, and an intermediate response was observed in gcn2 cells. This indicates that Gcn2 contributes to, but is not essential for, the activation of these genes by 3AT. These data are entirely consistent with our observation that Gcn2 is not essential for the GCN response in C. albicans.
| DISCUSSION |
|---|
|
|
|---|
kinase locus. GCN2 is the only C. albicans locus that encodes a protein with significant sequence similarity to GCN2 proteins from other organisms (Fig. 1A). Furthermore, no detectable eIF2
kinase activity is present in C. albicans cells lacking Gcn2 (Fig. 1B).
By analogy with S. cerevisiae (26), we initially predicted that Gcn2 might play a role in the C. albicans GCN response. Several of our observations suggested that this is the case. First, GCN2 inactivation attenuates the 3AT resistance of C. albicans (Fig. 2). Second, exposure to 3AT increases eIF2
kinase activity in C. albicans, and GCN2 encodes this activity (Fig. 1B). Third, transcript profiling revealed that 3AT induces the expression of some amino acid biosynthetic genes in C. albicans in a Gcn2-dependent fashion (Fig. 6; Table 2).
However, numerous observations suggest that the role of Gcn2 in the C. albicans GCN response is relatively minor (Fig. 7). First, Gcn2 inactivation affects C. albicans to a much lesser extent than S. cerevisiae with respect to their 3AT resistance and their growth in the absence of amino acids (Fig. 2). Second, the transcriptional activation of a GCRE reporter by Gcn4 is not dependent on Gcn2 (Fig. 3). One would have expected this GCRE reporter to be Gcn2 dependent if Gcn2 was essential for the increase in Gcn4 expression levels following 3AT exposure. Third, transcript profiling revealed that Gcn2 contributes to, but is not required for, the activation of many amino acid biosynthetic genes in response to 3AT (Fig. 6; Table 2). Consistent with this, we have observed that the GCN4 5'-leader region represses the expression of an ACT1-GFP reporter in C. albicans and that this repression is not dramatically released following exposure to 3AT (not shown).
|
If GCN4 expression is not regulated primarily by Gcn2, how is GCN4 activated in C. albicans? Our data indicate that GCN4 is regulated mainly at the transcriptional rather than the translational level. Transcript profiling indicated that 3AT stimulates GCN4 mRNA levels in wild-type C. albicans cells (Table 2). This was confirmed by Northern blot analyses of the GCN4 mRNA and of various types of GCN4-GFP fusion (Fig. 5 and 6) (46). Furthermore, these observations have been confirmed by RT-PCR (not shown).
All of the fungal GCN4 homologues studied to date are transcriptionally regulated, at least to some extent. In S. cerevisiae, GCN4 transcription increases about twofold in response to 3AT (2), although in this yeast GCN4 is regulated primarily at the translational level (26). In contrast, C. albicans GCN4 appears to be regulated mainly at the transcriptional level. This is similar to the situation in Neurospora crassa and Aspergillus niger, where the levels of the cpc-1 and cpcA mRNAs, respectively, increase significantly in response to 3AT (40, 48). Furthermore in Aspergillus nidulans, cpcA mRNA levels are autoactivated by CPCA via CPCA response elements (CPRE) in the cpcA promoter (27). Therefore, although C. albicans is often viewed as being more closely related to budding yeast, with respect to GCN regulation this dimorphic pathogen appears to be more closely related to filamentous fungi.
Gcn4 activates C. albicans gene transcription via the GCRE (Fig. 3) (46). This GCRE is present in the upstream regions of most of the C. albicans genes that were revealed by transcript profiling to be induced by 3AT in a Gcn4-dependent fashion. We also found that the GCRE is required for transcriptional activation of GCN4 in response to 3AT (Fig. 3). Taken together, these data suggest that Gcn4 might autoactivate the GCN4 gene during the GCN response. However, transcriptional induction of GCN4 was not blocked in gcn4 cells (Fig. 5). This indicates that while GCN4 might contribute to its own activation, it is not essential for this activation (Fig. 7), thereby implicating an additional factor.
It is possible that, under normal circumstances, this additional factor contributes to the early stages of the GCN response when Gcn4 levels are low. Then, once Gcn4 levels have started to increase, Gcn4 might autoactivate GCN4 transcription via the GCRE (Fig. 4), thereby accelerating the full induction of the GCN response. Under abnormal circumstances, when no functional Gcn4 is available (Fig. 5), the additional factor might be sufficient to induce gcn4-GFP expression, albeit with relatively slow kinetics.
Several interesting questions are raised by the possible existence of a positive autoregulatory feedback loop involving Gcn4. For example, how is GCN4 activation prevented in the absence of a signal? Also, how does GCN4 expression return to normal once the amino acid starvation signal is removed? Several factors might combine to prevent inappropriate activation and timely inactivation of the GCN response. For example, the repressive effect of the 5' leader might help to limit GCN4 expression levels in the absence of a signal. Also, the activity of the Gcn4 protein might be posttranslationally regulated. C. albicans Gcn4 contains PEST-like sequences, which by analogy with S. cerevisiae (29) appear to accelerate the degradation of the Gcn4 protein in the absence of a signal (21). Furthermore, the activation domain of S. cerevisiae Gcn4 is phosphorylated by cyclin-dependent protein kinases (11, 33). Hence, several possible posttranslational events might combine to down-regulate Gcn4 activity once C. albicans cells are released from amino acid starvation.
The fact that C. albicans and S. cerevisiae have diverged with respect to GCN regulation is not unexpected, for two main reasons. First, there are many precedents for the divergence of signaling modules in these fungi. For example, the Ras-cAMP, mitogen-activated protein kinase, and Tup1-Nrg1 modules, involved in morphogenetic signaling (5, 6, 8, 17, 32, 35, 41), the Rim101/Prr1 module, which mediates pH signaling (13, 15), and the Hog1 and Yap1/Cap1 modules, involved in stress signaling (1, 43), are conserved in C. albicans and S. cerevisiae. However, the cellular roles of some signaling modules have diverged. For example, Tup1 represses filamentous growth in C. albicans but stimulates pseudohyphal growth in S. cerevisiae (5). Rfg1 is a morphogenetic repressor in C. albicans, whereas its homologue, Rox1, is a hypoxic regulator in S. cerevisiae (28). Also, Msn2 and Msn4 mediate general stress responses in S. cerevisiae but not in C. albicans (38).
Second, S. cerevisiae and C. albicans have evolved in contrasting niches. Although Gcn4 is not required for the virulence of C. albicans during systemic infections (4), where amino acids are presumably plentiful, Gcn4 is required for biofilm formation (19), and it might be required at other infection sites. For example, the Gcn4 homologue CpcA is required for the virulence of Aspergillus fumigatus in pulmonary infections (30). Also, amino acid biosynthetic genes are up-regulated in C. albicans during phagocytosis (42). Presumably, the regulation of the C. albicans GCN response has evolved to optimize the metabolic fitness of this pathogen in the various niches it occupies within its mammalian host.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Present address: Flanders Interuniversity Institute for Biotechnology, Department of Molecular Microbiology, Katholieke Universiteit Leuven, B-3001 Leuven, Belgium. ![]()
Present address: The Babraham Institute, Babraham, Cambridge CB2 4AT, United Kingdom. ![]()
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Appl. Environ. Microbiol. | Infect. Immun. | J. Bacteriol. |
|---|---|---|
| Mol. Cell Biol. | Microbiol. Mol. Biol. Rev. | ALL ASM JOURNALS |