Previous Article | Next Article ![]()
Eukaryotic Cell, October 2004, p. 1185-1197, Vol. 3, No. 5
1535-9778/04/$08.00+0 DOI: 10.1128/EC.3.5.1185-1197.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Molecular Biology Institute and Department of Microbiology, Immunology and Molecular Genetics, University of California, Los Angeles, Los Angeles, California
Received 18 May 2004/ Accepted 13 July 2004
|
|
|---|
|
|
|---|
In contrast to other eukaryotes, where gene expression is primarily controlled at the level of transcriptional initiation, kinetoplastid gene expression is mainly regulated at posttranscriptional levels. Gene regulation in trypanosomes has been investigated mostly in species that undergo morphological and physical transformations during their life cycles. In most cases mRNA abundance and stability are determined by cis-regulatory sequences present in the 3' untranslated regions (UTR) of the transcripts (reviewed in reference 7). No developmental regulation at the level of RNA polymerase transcription has been reported.
trans-acting factors that might be involved in regulating mRNA stability have also been described from trypanosomes based on their functionality or sequence identity (reviewed in reference 10). These include a family of RNA binding proteins recently identified from Trypanosoma cruzi that shows highly restrictive binding interactions in vivo with specific mRNAs (9). Homologs of the poly(A) binding proteins (PABP) have also been described from several species of trypanosomes (3, 33) and Leishmania (2). Binding of PABP to the poly(A) tail of mature transcripts in higher eukaryotes has been shown to enhance message stability (11) and stimulate translation initiation (36).
In the trypanosomatid insect parasite Crithidia fasciculata, transcript levels of several genes that are involved in DNA metabolism have been shown previously to cycle throughout the cell cycle progression. mRNA levels of genes coding for the large subunit of nuclear single-strand DNA binding protein (RPA1), mitochondrial topoisomerase II (TOP2), dihydrofolate reductase-thymidylate synthetase, and a histone-like kinetoplast DNA binding protein (KAP3) were shown to cycle in parallel during the cell cycle (30). An octamer consensus sequence [(C/A)AUAGAA(G/A)] present in all of these transcripts is required for the cell cycle-dependent regulation of the mRNA levels (6, 32). The octamer sequences have been found in both the 5' UTR and 3' UTR of transcripts. Recent studies have shown that an octamer sequence present in the intergenic region of the KAP3 transcript is required in addition to octamer sequences within the 3' UTR for cell cycle-dependent regulation of KAP3 mRNA (1). The central hexamer (AUAGAA) is found to be highly conserved in transcripts that cycle. Mutations introduced in the hexamer sequence abolish the periodic accumulation of the mRNAs and result in constant mRNA levels close to maximum levels attained by the cycling transcripts (18).
To understand how this regulatory element affects mRNA cycling, we have identified the trans-acting factors that interact with these cis-regulatory elements. Gel shift assays showed the presence of cycling sequence-specific binding proteins in Crithidia cell lysates. The binding activity of these proteins varies during the cell cycle in parallel with the levels of putative target mRNAs. Target messages were found to accumulate when the binding activity was high (19, 27), suggesting that the variation in the levels of the cycling messages may be a consequence of the cell cycle-dependent periodic binding of the cycling sequence binding proteins to the cycling sequence.
Two cycling sequence binding activities, cycling sequence binding proteins (CSBP) (19) and CSBP II (27) identified in Crithidia whole-cell extracts, were reported previously. Two subunits of CSBP have been identified, a 37-kDa CSBPA and a 48-kDa CSBPB. Knockout of the CSBPA gene resulted in the loss of both CSBP subunits. However, target mRNA cycling in the CSBPA null mutant cells remained unaffected. Another cycling sequence binding activity, termed CSBP II, was identified and purified from the CSBPA null mutant cells. CSBP II binding is also specific for the cycling sequence and can be abolished by point mutations in the hexamer core (AUAGAA). CSBP II protein purified to homogeneity contains three major polypeptides, estimated to have molecular masses of 68, 52, and 35 kDa, based on migration in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels. Closer scrutiny revealed that the 52-kDa band is actually a doublet of closely migrating bands approximately 52 and 55 kDa in size. UV cross-linking of purified CSBP II showed three polypeptides, similar in size to the 68-, 52- and 55-, and 35-kDa proteins, that bind specifically to the wild-type RNA probe (27).
To study further the individual CSBP II proteins, we have cloned the genes encoding these proteins from a C. fasciculata genomic DNA library. We discuss here the binding properties of the three CSBP of predicted molecular masses based on gene sequences of 63 (RBP63), 44.5 (RBP45), and 33 kDa (RBP33) and corresponding to the proteins of 68, 52, and 35 kDa based on their migration on SDS gels. RBP63 has high sequence similarities to Trypanosoma brucei (14) and T. cruzi (3) poly(A) binding proteins. Both RBP45 and RBP33 were found to be phosphoproteins, and the levels of phosphorylation of these individual proteins vary during cell cycle progression.
|
|
|---|
Gene cloning.
Degenerate oligonucleotide primers were designed by using the amino acid sequences of putative homologs of the Crithidia CSBP II proteins obtained from the L. major database. Primers J82 (GGRTTDATGTTCTCCATCCA) and J95 (AACATHATHATGCAGATG) were used to amplify an 800-bp fragment of the RBP45 gene by using Leishmania tarantolae genomic DNA as a template. Similarly, primers L50 (CATGTGGATGCNATGATHAC) and L51 (GTATCCGGCTCCATCCADAT) were used to amplify a 690-bp fragment of the RBP33 gene homolog from L. tarantolae. Both PCR products were individually cloned into the pCR2.1 TOPO vector (Invitrogen) and sequenced to confirm their identity. The L. tarantolae gene fragments were then used as probes to screen a Crithidia genomic library (31) in
-GEM11 (Promega) to obtain full-length clones of the Crithidia RBP45 and RBP33 genes. A 3.1-kb EagI DNA fragment containing the 5' UTR and about 1.1 kb of the coding region of the RBP45 gene (corresponding to about 98% of the coding region) was obtained by digestion of DNA from a
clone that was found to contain the RBP45 gene. The fragment was subcloned into the pGEM13z(+) vector and sequenced. The DNA sequence for the rest of the RBP45 gene and its 3' UTR region was obtained by direct sequencing of the
clone DNA. Primers L14 (AATGGTTGTAGAAGAGGGTGG) and L10 (TACAGAGAGTGCGTGGAGACAAGC) were designed based on the acquired sequence information. Finally a 3.6-kb fragment containing the whole of the RBP45 gene was amplified from Crithidia genomic DNA by using Vent DNA polymerase and primers L14 and L10 as forward and reverse oligonucleotide primers, respectively. The PCR product was treated with Taq polymerase for 5 min at 72°C and cloned into the pCR2.1 TOPO vector and sequenced.
A 3.1-kb gene fragment containing the coding region of the RBP33 gene, flanked by 1 kb of 5' and 3' UTRs on either end, was obtained from a MluI digest of DNA of a
clone that was found to contain the gene. The fragment was cloned in the pGEM7z(+) vector that had its Bsp120I restriction site destroyed by site-directed mutagenesis beforehand to obtain the plasmid construct pBM35.
A 1.6-kb fragment of the PABP gene was amplified directly from Crithidia genomic DNA by using the following primers that were developed based on the L. major RBP63 gene sequence (EMBL accession number AC016528): 5' primer, K20 (CACTGGTCCGAATCCCTCAATC), and 3' primer, K19 (GAAGCATACCCGTGATCTTGGC). The PCR product was cloned in the pCR2.1 TOPO vector and sequenced. The fragment was then used as a probe to screen the Crithidia
-GEM11 genomic library to obtain the full-length clone. A
6-kb MluI fragment containing the total PABP gene was subcloned in pGEM7z(+).
Recombinant protein expression and purification. RBP63, RBP45, and RBP33 open reading frames were amplified by PCR and cloned into the NdeI and XhoI sites of the pET22b(+) expression vector (Novagen). The constructs were used to transform Origami B cells (Novagen). Transformed Escherichia coli cultures were induced by the addition of isopropyl thiogalactoside, and soluble His-tagged recombinant proteins were purified with His-bind resin (Novagen). Insoluble recombinant proteins were solubilized, purified from inclusion bodies as described previously (19), and used for immunization to raise antibodies.
Expression of HA-tagged RBP33 in C. fasciculata. Plasmid pBM35 was engineered to introduce a PspOMI site into the carboxy terminus of the RBP33 gene just prior to the stop codon, by using the QuikChange XL mutagenesis kit (Stratagene). Three copies of the hemagglutinin (HA3) epitope were cloned into the PspOMI site. A hygromycin phosphotransferase cassette (8) was cloned downstream of the RBP33 gene to obtain the construct pBM35-HA. Wild-type C. fasciculata cells were transformed with the expression plasmid and selected on nutrient plates containing 80 µg of hygromycin per ml as described elsewhere (30).
In vitro transcriptions and gel shift assays. Gel shift assays were performed with 32P-labeled RNA probes containing six copies of either the wild-type cycling sequence (CAUAGAAG) or a mutated sequence (CAUAGcAG, where a point mutation is indicated by the lowercase letter). RNA probes were prepared from NotI-linearized plasmids pRM16 and pRM23, containing six copies of either the wild-type cycling sequence (RM16) or its mutated version where the adenine at the sixth position of the octamer has been changed to cytosine (RM23), by using the Maxiscript kit (Ambion) as described elsewhere (27). Binding reactions (20 µl) (20) were performed for 20 min at 28°C in the presence of 10 mg of heparin and 10 U of the RNase inhibitor RNasin. For supershift assays, antibodies were added to the reactions and incubated for another 15 min. RNA-protein complex formation was analyzed by observing the relative shifts in mobility of the labeled RNA probe, when samples were electrophoresed on 6% polyacrylamide gels (ratio of acrylamide to bisacrylamide, 60:1), 15 cm in length, unless stated otherwise. All gel electrophoreses were carried out at 150 V for 3 h at 4°C in 0.5x Tris-borate EDTA buffer, following a preelectrophoretic run for 45 min under the same running conditions. The gels were dried and exposed to X-ray films for autoradiography. For quantitative analysis of RNA-protein complex formation, dried gels were exposed to a PhosphorImager screen, and radioactive bands were quantitated with a PhosphorImager (Amersham Biosciences).
Preparation of whole-cell extracts from C. fasciculata.
Fifty milliliters of Crithidia cultures grown to a density of
2 x 107 to 4 x 107 cells/ml was harvested by centrifugation for 5 min at top speed in a clinical centrifuge. The cells were washed once with ice-cold phosphate-buffered saline and placed on ice for 2 min, before being resuspended in 250 µl of buffer A (0.1 M HEPES [pH 7.9], 0.8 M NaCl, 1 mM dithiothreitol [DTT], 20 µg of leupeptin per ml). Twenty-five microliters of 20% Nonidet P-40 was added to the cell suspension and quickly mixed by brief vortexing. A total of 170 µl of buffer B (50 mM HEPES [pH 7.9], 0.4 M NaCl, 80% glycerol, 1 mM DTT, 20 µg of leupeptin per ml) was then added and mixed thoroughly by gentle pipetting. Another 250 µl of buffer C (50 mM HEPES [pH 7.9], 0.4 M NaCl, 20% glycerol, 1 mM DTT, 20 µg of leupeptin per ml) was added, mixed thoroughly, and incubated for 15 min at 4°C on a rocking platform. The lysate was then centrifuged at 16,000 x g in a cold microcentrifuge for 15 min, and the supernatant was carefully poured off. The supernatant, containing the cycling sequence binding activity, was aliquoted into several tubes, quick-frozen in dry ice, and stored at 70°C for future use.
Crithidia whole-cell extracts were prepared for coimmunoprecipitation of RBP45 protein bound to target messages, which was also carried out similarly. However, all chemicals used in buffer preparation were pretreated with diethyl pyrocarbonate, and all buffers contained 100 U of the RNase inhibitor RNasin per ml.
Immunoprecipitations. Fifty microliters of Crithidia cell lysate was diluted to a 200-µl final volume by the addition of dilution buffer D (50 mM HEPES [pH 7.9], 150 mM NaCl, 20% glycerol, 1 mM DTT, 20 µg of leupeptin per ml). Affinity-purified chicken anti-RBP45 anti-immunoglobulin Y (IgY) was added to the lysate at a 1:50 dilution and incubated at 4°C for 3 h on a rocking platform. A 50-ml slurry of goat anti-chicken IgY coupled to activated agarose matrix (Promega) was then added to each reaction and incubated further for another hour. IgY bound to agarose was recovered by a 30-s centrifugation in a microcentrifuge, and the supernatant was carefully removed. The agarose beads were washed three times with 500 µl of cold Tris-buffered saline containing Tween 20 and two times with Tris-buffered saline. After the final wash, proteins were eluted with 2x Laemmli gel loading buffer (15).
Antibodies. Chicken IgY antibody specific for RBP45 was generated by the immunization of chickens with purified recombinant RBP45 protein by Aves Labs Inc. (Tigard, Oreg.). IgY purified from egg yolks of immunized chickens was further purified on an affinity column prepared by conjugating purified recombinant RBP45 protein to CNBr-activated Sepharose 4 Fast Flow matrix (Amersham Biosciences). The purified anti-RBP45 antibody was used at a dilution of 1:2,000 in Western blot analyses and at a 1:50 dilution in immunoprecipitation experiments. Mouse monoclonal antibody 12CA5 (BAbCO) was used at a 1:5,000 dilution for detecting HA epitope-tagged proteins. Rabbit polyclonal antibodies against T. brucei PABP were used at a 1:1,000 dilution in Western blotting. Rabbit antiphosphoserine, rabbit antiphosphothreonine, and mouse antiphosphoserine antibodies (Zymed laboratories Inc.) were used for detecting phosphorylated RBP45 at dilutions of 1:1,000, 1:1,000, and 1:500, respectively.
Western blotting. Protein samples fractionated by SDS-10% PAGE were transferred to Protran nitrocellulose membrane (Schleicher and Schuell) and probed with primary antibodies at the above dilutions. Blots were developed by using horseradish peroxidase-conjugated anti-chicken (Promega), anti-mouse, or anti-rabbit (Sigma) secondary antibodies and Supersignal West Pico chemiluminescent substrate (Pierce), according to the manufacturer's protocol.
In vivo cycling sequence binding studies. Whole-cell extracts were prepared from Crithidia cells transfected with plasmids containing six copies of the wild-type cycling sequence in the sense (pRM18) or antisense (pRM18R) orientation, upstream of a CaBP gene fragment (18). Fifty microliters of extract was diluted by the addition of 100 µl of dilution buffer D. Immunoprecipitation was carried out as described earlier. The final washed agarose beads were resuspended in 0.1% SDS and incubated at 65°C for 10 min. RNA was recovered from the digested samples by phenol-chloroform extraction and ethanol precipitation. Precipitated RNA was resuspended in water and then used for cDNA synthesis by reverse transcription (RT)-PCR by using primer B60 (GATCCGCGGTTACTCCATGCTGAGCTTGCCG) designed from the CaBP gene sequence. Primer M51 was designed specifically to the pRM18 sequence, containing the first of the six CATAGAAG octamer repeat sequences in its 3' end. PCR performed with M51 as forward primer and M52 (developed from the downstream CaBP gene fragment) as reverse primer was expected to generate an amplification product of 268 bp. Oligonucleotide M50 was designed from the pRM18R sequence and contains the last of the six CTTCTATG repeat sequences at its 5' end. PCR amplification with M50 and M52 was expected to produce a 202-bp DNA fragment (see Fig. 2).
![]() View larger version (95K): [in a new window] |
FIG. 2. RBP45 binds to the wild-type cycling sequence in vitro. (A) Western blot analysis of Crithidia whole-cell extract by using affinity-purified anti-RBP45 IgY. (B) Supershift binding assays were performed by using UnoQ column-purified CSBP II prepared from CSBPA null mutant cells and increasing concentrations of anti-RBP45 IgY. The samples were electrophoresed in 4% polyacrylamide gel (ratio of acrylamide to bisacrylamide, 30:1) for 4 h 15 min at 150 V. (C) Binding assays were done with purified recombinant RBP45 by using 32P-labeled RNA probes containing six copies of the wild-type cycling sequence (6x CAUAGAAG) or six copies of its mutated form (6x CAUAGcAG).
|
|
|
|---|
![]() ![]() View larger version (166K): [in a new window] |
FIG. 1. Comparison of predicted amino acid sequences of proteins associated with Crithidia CSBP II and other kinetoplastid homologs using ClustalW alignment. (A) Alignment of Crithidia (Cf) RBP45 sequence with hypothetical L. major (Lm) protein (EMBL accession no. AC009605). (B) Alignment of Crithidia RBP33 with protein sequences obtained from L. major (LmjF11.0140), T. brucei (Tb11.02.4990), and T. cruzi (Tc00.1047053511163.40) databases. (C) Alignment of Crithidia (Cf) RBP63 protein sequence with predicted PABP sequences from L. major (Lm2; EMBL accession no. AC016528), PAB-1 (Lm1; EMBL accession no. AAC64372); T. brucei (Tb; EMBL accession no. AAD13337), and T. cruzi (Tc; EMBL accession no. AAC46487) PABP sequences. PSP1 domains in RBP45 and RBP33 are outlined with boxes. Gray lines mark peptide sequences obtained by MS/MS analysis of Crithidia proteins. L. major amino acid sequences used to design degenerate oligonucleotide primers for PCR amplification of the genes have been marked by arrows. (D) Diagram of the sequence and domain organization of Crithidia RBP63.
|
BLAST searches performed with RBP45 and RBP33 amino acid sequences revealed the presence of hypothetical proteins with high sequence similarity in other kinetoplastid organisms (Fig. 1A and B). However, these proteins have no significant homology to proteins from other organisms. Surprisingly, analysis of RBP45 and RBP33 amino acid sequences did not predict any known RNA binding motif but indicated the presence of a PSP1 domain (12).
RBP45 binding to the cycling element is sequence specific. Earlier UV cross-linking experiments with RNA affinity-purified CSBP II revealed the presence of a protein, with a molecular mass of approximately 52 kDa, that binds specifically to the wild-type cycling sequence (27). To confirm the presence of RBP45 in CSBP II, supershift assays were performed by using affinity-purified anti-RBP45 antibodies developed against recombinant RBP45 protein. The anti-RBP45 antibodies specifically recognize a single 52-kDa band in Western blotting of whole-cell extracts. Purified CSBP II UnoQ fraction (27) was used to bind 32P-labeled RM16 probe in gel shift assays. The addition of anti-RBP45 antibody to the binding reaction resulted in supershifting of the RNA-protein complex upon gel electrophoresis (Fig. 2B). These results identify the 52-kDa band in the CSBP II protein complex as the RBP45 protein.
To investigate the RNA binding activity of RBP45 alone, recombinant RBP45 protein was used in gel shift assays with 32P-labeled wild-type RNA (RM16), containing six copies of the CAUAGAAG sequence (6x CAUAGAAG), and mutant RNA (RM23), containing six copies of the mutated octameric sequence CAUAGcAG (6x CAUAGcAG) as probes (Fig. 2C). The binding of recombinant RBP45 was found to be specific for the wild-type RNA sequence, indicating that the RBP45 component of the Crithidia CSBP II protein complex has the ability to bind specifically to the cycling sequence.
Binding of RBP45 protein to cycling sequence in vivo.
To determine if the RBP45 protein in CSBP II also binds the cycling sequences in mRNAs that are known to cycle during the cell cycle, we used Crithidia cell lines containing reporter plasmids pRM18 and pRM18R (18). Transcript levels of plasmids pRM18 and pRM18R, which contain six copies of the octameric cycling sequence in sense (pRM18) or antisense (pRM18R) orientation, were quantitated at different times during the cell cycle in hydroxyurea-synchronized cultures. Transcript levels of pRM18 plasmid were found to cycle strongly during the cell cycle, but levels of pRM18R did not cycle (18). The in vivo binding properties of RBP45 to a target mRNA were examined by coimmunoprecipitation of reporter transcripts with RBP45 by performing RT-PCR on RNA isolated from RBP45 immunoprecipitates. The cDNAs synthesized from RNA isolated from pRM18 and pRM18R immunoprecipitates were further subjected to PCR amplification with specific primers (Fig. 3B). An RT-PCR amplification product of expected size (
268 bp) was observed with RBP45- coimmunoprecipitated RNA from pRM18 cells. A similar experiment performed by using IgY from preimmune sera (data not shown) or without the addition of any IgY antibody did not give any RT-PCR product. No amplified DNA fragments were observed in experiments performed with or without the addition of the anti-RBP52 antibody when pRM18R cell lysate was used. RT-PCR amplification of total RNA extracted from 1/10 of the volume of pRM18 and pRM18R lysates used in immunoprecipitation reactions generated DNA fragments of
270 and
200 bp, respectively, as expected for both the reporter constructs. Control amplification reactions using the immunoprecipitated RNA alone did not generate any PCR products, indicating that the immunoprecipitate was free of DNA contamination (Fig. 3C). Western blot analyses (Fig. 3D) confirmed that RBP45 was immunoprecipitated efficiently from both the pRM18 and pRM18R cell lysates. These data indicate that RBP52 binds specifically to target messages containing the octameric cycling sequence in vivo.
![]() View larger version (36K): [in a new window] |
FIG. 3. RBP45 binds to the cycling sequences in target mRNAs that cycle during cell cycle in vivo. (A) Schematic representation of the plasmid constructs pRM18 and pRM18R containing six copies of the cycling sequence in sense and antisense orientations. RNA that coimmunoprecipitated with RBP45 was reverse transcribed with primer B60. Primers M51 and M52 were used for PCR amplification of pRM18; primers M50 and M52 were used to amplify pRM18R. (B) RT-PCR of RNA that coimmunoprecipitated with RBP45. Also, RNA was extracted from 1/10 of the volume of whole-cell lysate used for immunoprecipitation reactions and was amplified by RT-PCR. (C) PCR amplifications were performed with primers M51 and M52 by using anti-RBP45-immunoprecipitated RNA alone (lane 1) or reverse-transcribed DNA prepared from the anti-RBP45-immunoprecipitated RNA with primer B60 and Vent polymerase (lane 2). (D) Western blotting to detect RBP45 in immunoprecipitates obtained from lysates of pRM18 and pRM18R plasmid containing Crithidia cells, with (lanes 3 and 6) and without (lanes 3 and 5) the addition of anti-RBP IgY. Lanes 1 and 4 show the RBP45 content in 5% of the input volume of lysates used in the immunoprecipitation reactions.
|
![]() View larger version (55K): [in a new window] |
FIG. 4. RBP45 is phosphorylated at a serine residue(s). The purified CSBP II UnoQ fraction shown in lane 1 was subjected to immunoprecipitation by the addition of purified chicken anti-RBP45 IgY. Approximately 90 (lane 2) and 10% (lane 3) of the immunoprecipitate was electrophoresed in an SDS-8.5% polyacrylamide gel (15 cm long; 23 mA constant current for 4 h) and subsequently transferred to a nitrocellulose membrane for Western blotting. The blot was then probed with chicken anti-RBP45 antibodies (A) or rabbit antiphosphoserine (B). (C) Whole-cell extracts prepared from Crithidia CSBPA null mutant cells were incubated at 37°C in -PPase buffer with or without the addition of 10 U of -PPase enzyme over a 20-min time period. Equal volumes were taken out of the reaction mixture at designated times, mixed with Laemmli buffer, and heated at 95°C for 5 min. Samples were electrophoresed in an SDS-8.5% polyacrylamide gel under the conditions described above and transferred by Western blotting to nitrocellulose, which was then detected with anti-RBP45 antibody.
|
protein phosphatase (
-PPase), which has activity towards phosphorylated serine, threonine, and tyrosine residues. Western blots of the digested samples, detected with anti-RBP45 IgY, showed a gradual conversion of the slower-migrating 55-kDa band species to the faster-migrating (
52-kDa) one (Fig. 4C). The Western blot analysis and
-PPase digestion data together indicate that the doublet of RBP45 is due to phosphorylation of the protein at a serine residue(s). RBP33 is a phosphoprotein. Wild-type Crithidia cells were transformed with the construct pBM35HA for expressing HA-tagged RBP33 (RBP33-HA3) protein. Western blot analyses (Fig. 5A) with 12CA5 antibody detected in the transformed Crithidia cell extracts the expression of a major HA-tagged protein whose migration was consistent with an estimated molecular mass of approximately 37 kDa. The blot was reprobed with anti-hsp70 antibody to control for the amounts of protein loaded into each lane. However, in addition to the 37-kDa band, the anti-HA antibody also detected several other slower- migrating bands in the RBP33-HA3 cell lysate.
![]() View larger version (40K): [in a new window] |
FIG. 5. Crithidia RBP33 protein is a phosphoprotein. (A) Western blotting of wild-type (WT) Crithidia and Crithidia cells transformed with RBP33-HA3 by using monoclonal antibodies against the HA tag. The same blot was stripped and reprobed with anti-hsp70 antibody to compare loading between the lanes. (B) Whole-cell extracts prepared from Crithidia cells expressing RBP33-HA3 were incubated with or without the addition of 10 U of -PPase enzyme at 37°C. Equal volumes were removed from the reaction at designated times, electrophoresed in an SDS-10% polyacrylamide gel, and analyzed by Western blotting with anti-HA antibody.
|
protein phosphatase (Fig. 5B). No changes in the migration pattern of the HA-tagged proteins were observed when the cell extract was incubated in
-PPase buffer alone. However, the
-PPase treatment of the extract showed a decrease in the intensity of the slower-migrating bands and a corresponding increase in intensity of the 37-kDa band, which is consistent with the conversion of phosphorylated slower-migrating forms of RBP33-HA3 to a faster migrating dephosphorylated form. RBP33 binds specifically to the wild-type cycling sequence. Whole-cell extracts prepared from Crithidia wild-type cells and cells expressing HA-tagged RBP33 protein showed similar gel shift properties when used in binding assays with radiolabeled RM16 probe (Fig. 6A). The addition of anti-HA antibody 12CA5 and further incubation of the reaction for another 15 min resulted in supershifting of the RNA-protein complex formed with the RBP33-HA3 extract. No change in migration pattern was observed for the RNA-protein complex formed with wild-type cell extract. The results confirmed the presence of the HA-tagged RBP33 protein in the CSBP II complex. To directly examine the binding of RBP33 to the cycling sequence, recombinant RBP33 protein was assayed for its ability to bind the cycling sequence (Fig. 6B). Gel shift assays performed with different amounts of the recombinant protein showed that RBP33 binds to the wild-type probe (containing 6x CAUAGAAG) with high specificity. Higher shifts observed with increased concentrations of the recombinant protein by using the wild-type RNA probe (Fig. 4B, lane 3) were possibly due to multiple binding of the protein molecules to the probe. Very little binding was observed with the mutant probe (containing 6x CAUAGcAG), but the shift obtained was different from that with the wild-type probe. Also, as the intensity of the band did not increase with a higher amount of recombinant RBP33, we did not further characterize this band in the present study.
![]() View larger version (101K): [in a new window] |
FIG. 6. RBP33 binding to the cycling sequence. (A) Gel shift assays were performed with whole-cell extracts prepared from wild-type (WT) cells as well as cells expressing HA-tagged RBP33. Supershift of the RNA-protein complex was carried out by adding mouse 12CA5 antibody against the HA tag. The samples were electrophoresed in a 4% polyacrylamide gel (ratio of acrylamide to bisacrylamide, 30:1) for 3 h at 150 V. (B) RNA gel shift assays to determine the binding specificity of purified recombinant RBP33 protein by using wild-type (containing 6x CAUAGAAG) and mutant (containing 6x CAUAGcAG) probes.
|
![]() View larger version (70K): [in a new window] |
FIG. 7. Poly(A) binding protein is contained in the CSBP II protein complex. (A) Rabbit antibody developed against T. brucei PABP detects the Crithidia PABP in Western blot analysis of Crithidia total cell lysates. (B) Supershift assays were performed with purified CSBP II (UnoQ fraction) in the absence or presence of increasing concentrations of anti-PABP antibody. The samples were electrophoresed in a 4% polyacrylamide gel (ratio of acrylamide to bisacrylamide, 30:1) for 3 h 15 min at 150 V.
|
![]() View larger version (85K): [in a new window] |
FIG. 8. RBP63 binds to the cycling sequence. (A) SDS-PAGE analysis of recombinant RBP63 (lane 2). Western blot analysis of the purified RBP63 generated by using antibodies specific to T. brucei poly(A) binding protein (lane 3). Lane 1, molecular mass markers. (B) UV cross-linking assays were performed by using purified recombinant RBP63 and wild-type (WT) or mutant (Mut) RNA probes containing six copies of wild-type (CAUAGAAG) or mutated (CAUAGcAG) cycling sequence. (C) UV cross-linking assays using recombinant RBP63 and wild-type probe were carried out in the presence or absence of ribohomopolymers as competitors.
|
Differential levels of phosphorylation of RBP45 and RBP33 during the cell cycle. Protein levels of RBP45 and RBP33 did not vary during the cell cycle (data not shown). However the levels of phosphorylation of these proteins have been found to vary during the cell cycle. Cell extracts prepared from cells taken at 30-min intervals from a hydroxyurea-synchronized culture of CSBPA null mutant Crithidia were immunoprecipitated with anti-RBP45. Western blot assays with the postimmunoprecipitation supernatant were done to confirm that all of the RBP45 protein was immunoprecipitated from the extract. Western blot detection with anti-RBP45 antibody revealed a difference in intensities of the 55- and 52-kDa bands in the immunoprecipitates (Fig. 9A). As shown in Fig. 9B, the increase in the abundance of one band was correlated with the decrease of the other. The ratio of the 55- to 52-kDa band intensities in each lane was obtained to estimate the level of phosphorylation at each time. The levels of the phosphorylated form of RBP45 (55-kDa band) were approximately 2- and 1.8-fold higher than those of the 52-kDa band, representing dephosphorylated RBP45, at 0 and 150 min, respectively, following release from the hydroxyurea arrest. At 90 and 210 min, however, the relative levels of phosphorylated RBP45 were only approximately 0.6 and 0.7 times, respectively, that of the RBP45. It should be noted that while the relative level of phosphorylation of RBP45 only varied by approximately twofold during the cell cycle experiment, the actual variation is likely to be much greater due to imperfect synchronization of the culture.
![]() View larger version (63K): [in a new window] |
FIG. 9. Phosphorylation of RBP45 is cell cycle dependent. Whole-cell extracts were prepared from a synchronized culture of Crithidia CSBPA null mutant cells at 30-min intervals after removing the hydroxyurea block. (A) Extracts containing 10 µg of protein were assayed for their cycling sequence binding ability by using 32P-labeled wild-type octamer (containing 6x CAUAGAAG) RNA probe. (B) Whole-cell extracts at each time were immunoprecipitated with anti-RBP45 IgY. Isoforms of the RBP45 protein in the whole-cell extracts were then detected by Western blot analysis of the immunoprecipitates. (C) Graphical representation of RNA binding activity (open squares) and the ratio of phosphorylated to dephosphorylated forms of RBP45 (filled diamonds) in synchronized cells at 30-min intervals. RNA binding activity was quantitated by phosphorimaging analysis of the dried RNA gel shift assay gel.
|
RBP33 phosphorylation levels at different times during the cell cycle were measured by quantitating the total intensity of the bands in the
39- to 45-kDa range that migrated slower than the 37-kDa band by means of Western blotting with cell extracts prepared from hydroxyurea-synchronized Crithidia cells expressing HA-tagged RBP33 protein. Cells were removed at 30-min intervals following release from hydroxyurea arrest. As shown in Fig. 10B, the abundance of the phosphorylated bands varied during the cell cycle, reaching maximum levels at 120 min. Cycling of binding activity was also evident when the extracts were examined for their abilities to bind cycling sequence with the RM16 RNA probe (Fig. 10A). Figure 10C shows a graphic representation of the levels of RBP33 phosphorylation and cycling sequence binding activities at various times during the cell cycle. The binding activity peaked at times when the RBP33 was least phosphorylated. On the other hand, an increase in RBP33 phosphorylation coincided with the loss in cycling sequence binding activity.
![]() View larger version (59K): [in a new window] |
FIG. 10. Cell cycle-dependent phosphorylation of RBP33. Whole-cell extracts were prepared at 30-min intervals from hydroxyurea-synchronized Crithidia cells expressing HA-tagged RBP33 (RBP33-HA3) protein. (A) Gel shift assays of the extracts (containing 10 µg of protein) were performed by using 32P-labeled wild-type octamer (containing 6x CAUAGAAG) RNA. The extent of binding was measured by quantitating the radioactivity in the band of RNA protein complex by PhosphorImager analysis. (B) Western blot analysis of RBP33-HA3 protein in whole-cell extracts prepared at 30-min intervals. Ten micrograms of protein was loaded in each lane. (C) Graphical representation of the RNA binding activity (open squares) and relative amount of phosphorylated forms of RBP33-HA3 (filled diamonds). The phosphorylation level of RBP33-HA3 protein in each lane was estimated from the relative fluorescent intensity of slower-migrating protein forms (indicated by a bracket) by using a Bio-Rad Versicolor gel documentation system.
|
|
|
|---|
Homologs of the CSBP II proteins were identified in the L. major database by using peptide sequences obtained from MS/MS spectra analysis of C. fasciculata CSBP II proteins and taking advantage of the high sequence similarity between the Crithidia and Leishmania genomes. Comparison of Crithidia RBP45 and RBP33 protein sequences with their Leishmania homologs showed high sequence identity. Although RBP45 homologs have not been identified in the trypanosoma databases, T. brucei and T. cruzi homologs of RBP33 have been identified. Sequences of both Crithidia and Leishmania RBP45 and RBP33 proteins are found to be conserved at the carboxy-terminal half that contains a PSP1-like motif. The motif was originally observed in the yeast PSP1 protein, which is reported to be involved in suppressing mutations in the DNA polymerase alpha subunit in Saccharomyces cerevisiae (12). The PSP1 motif has also been identified in several hypothetical proteins from both eukaryotic and eubacterial sources, but the actual biological significance of the motif has not yet been clearly established. Searches in the L. major and T. brucei databases identified several hypothetical proteins that also contain the PSP1 motif. It will be interesting to determine if these hypothetical proteins share any functional relation.
No common RNA binding motif was identified in either of these cycling sequence binding proteins. This lack of an identified RNA binding motif is not entirely surprising, as similar observations were previously reported for CSBPA and CSBPB proteins, subunits of the CSBP complex (19). In vitro binding studies with recombinant RBP45 and RBP33 proteins showed that both proteins bind specifically to the octamer cycling sequence (containing 6x CAUAGAAG) and not to the mutant probe (containing 6xCAUAGcAG). This result is similar to our earlier observation that the 52- and 35-kDa proteins in purified CSBP II bind specifically to the wild-type cycling sequence (27). We note that while CSBPA and CSBPB proteins are related (19) and RBP45 and RBP33 proteins share common domains, the pairs are unrelated to each other. A common structural motif responsible for the binding specificity might possibly be revealed once the structures of these proteins have been determined. Supershift assays confirmed that both the RBP45 and RBP33 proteins are present in the CSBP II complex. In addition, RBP45 binds in vivo only to target mRNAs with wild-type cycling sequences, as only the transcripts from reporter constructs that contained six copies of the wild-type cycling sequence in sense orientation were found to coimmunoprecipitate with the RBP45 protein. Binding of RBP45 to the cycling sequence element in vivo adds further support for a direct role of the CSBP II complex in modulating the levels of mRNAs containing such sequences.
RBP63, the third member of the CSBP II protein complex, is predicted to be a poly(A) binding protein. The Leishmania and Crithidia RBP63 proteins are found to be 86% identical in sequence to one another and 68% identical to known poly(A) binding proteins from T. brucei (33) and T. cruzi (3). Western blotting with antibodies developed against Crithidia RBP63 or T. brucei PABP identified polypeptide bands of the same size in Crithidia whole-cell lysate. The T. brucei anti-PABP antibody also efficiently precipitated the RBP63 protein from Crithidia cell lysates (data not shown). Although the chicken antibody developed against Crithidia RBP63 protein was highly efficient in detecting the protein on Western blotting, it did not efficiently recognize the native protein in lysates. Supershift assays performed by adding T. brucei anti-PABP antibody to binding reactions containing CSBPA null mutant extract and wild-type probe resulted in a shift of the RNA-protein complex, confirming the presence of RBP63 in the CSBP II protein complex.
RBP63 contains four distinct RRM at the amino-terminal half and a poly(A) binding domain at the carboxy-terminal half, common to all members of the PABP family. Although there is no consistent sequence homology in the linker region between the fourth RRM and the PABPC domain of PABP from distantly related organisms, there is rather a bias for the amino acids proline, glutamine and, to a lesser extent, asparagine and a lack of acidic residues (26). This feature is evident in sequences of both Crithidia and Leishmania RBP63 proteins. In addition, the linker region shows unique repeats of glycine, asparagine, and methionine residues. For the L. major RBP63, the stretch is of 48 amino acids (corresponding to amino acids 426 to 474) and contains 10 MGG repeats. Crithidia RBP63 has a similar but shorter stretch of 20 amino acids and contains four MGG repeats (Fig. 1C). The proline-glutamine-rich linker region has been reported to be involved in protein-protein interactions (21). It is possible that the repeat sequences in the RBP63 linker might be involved in specific protein-protein interactions with other partners in CSBP II.
Affinity purification of recombinant His-tagged RBP63 fusion protein resulted in copurification of three proteins with molecular masses of approximately 68, 56, and 48 kDa. Western blot analyses confirmed that the 56- and 48-kDa polypeptides are degradation products of the RBP63 protein that result from cleavage near the carboxy-terminal end. That the 48-kDa protein cross-links so efficiently with RNA probes suggests that the cleavage occurs in the linker region between the fourth RRM motif and the PABPC domain and that the RNA binding domains are retained in the 56- and 48-kDa fragments of RBP63. Breakdown products of similar sizes was also observed earlier during the purification of native (3, 33) and recombinant (14) PABP from other kinetoplastid sources.
PABP are well known for their ability to bind with high affinity to poly(A) tails of mRNAs, a prerequisite for mRNA stabilization and stimulation of translational activation. However, with lower affinity, PABP have been reported to bind with non-poly(A) sequences. A PABP has been shown to bind the 395-nucleotide-long dendritic localizer sequence of vasopressin mRNA in rat nerve cells (28). Also, RB47, a member of the PABP family, was shown to bind the 5' UTR of Chlamydomonas reinhardtii chloroplast psbA mRNA with high specificity (39). However, it is interesting that the recombinant RBP63 protein shows approximately a 10-fold preference in binding the wild-type RNA probe (containing 6x CAUAGAAG) compared to mutant probe (containing 6x CAUAGcAG). In binding reactions carried out with ribohomopolymers as competitors, poly(A) competed out the binding to the probe containing 6x CAUAGAAG, as would be expected. Similar experiments carried out with higher concentrations of poly(C), poly(G), and poly(U) competitors were found to be inefficient in competing out the binding with the probe containing 6 x CAUAGAAG.
Earlier, another poly(A) binding activity called Lm-PAB1 was identified in L. major cells and was reported as the major cytoplasmic poly(A) binding activity, accounting for more than half of the total PABP activity in the cell (2). However, LmPAB-1 was unable to rescue the lethality of S. cerevisiae pab mutant cells. The Lm-PAB1 protein has two isoforms, a 69- and a 75-kDa form. The 75-kDa form is a hyperphosphorylated form and is sensitive to the level of mRNA abundance in the cell. Both Crithidia and Leishmania RBP63 proteins show only 30% homology with the L. major PAB-1 protein. The presence of multiple PABP has been reported in higher eukaryotic cells, which carry out specialized functions in addition to their common poly(A) binding activity (reviewed in reference 22). Identification of more than one PABP in L. major cells further suggests that apart from binding to poly(A)tails of mRNAs, these proteins might have their own additional special functions in vivo.
To investigate the mechanism responsible for the cycling of binding activity, the levels of CSBP II proteins were examined during the cell cycle. Western blotting performed with cell extracts prepared from synchronized Crithidia cultures showed that levels of the RBP63, RBP45, and RBP33 proteins remained constant throughout the cell cycle (data not shown). However, multiple bands were detected in the Crithidia cell extracts in Western blots using affinity-purified anti-RBP45 IgY or anti-HA monoclonal antibodies. Digestion with
-PPase enzyme confirmed that both RBP45 and RBP33 proteins are phosphoproteins. Both RBP45 and RBP33 were found to be phosphorylated differentially during progression through the cell cycle. RBP45 phosphorylation levels cycled in parallel to the cycling sequence binding activity in synchronized Crithidia cultures. The maximum level of RBP45 phosphorylation was followed by a peak in binding activity at approximately 30 min later. Also, a reduction in levels of RBP45 phosphorylation was followed by a decrease in binding activity.
In contrast, phosphorylation levels of RBP33 protein cycled inversely with the cycling sequence binding activity. The protein was mostly dephosphorylated when the cycling sequence binding activity was highest and vice versa. Phosphorylation is probably not required for binding of these proteins to the target sequences since recombinant forms of both the RBP45 and RBP33 proteins are able to bind the RNA probe. However, the levels of phosphorylation of these proteins might play an important role in the function of the CSBP II complex during the cell cycle. It will be interesting to study the interaction of the RBP45 and RBP33 proteins with the RBP63 protein, as PABP are known to play a crucial role in regulating mRNA stability. It will also be important to examine the composition of the CSBP II complex at different times during the cell cycle.
Recently Avliyakulov et. al. have reported a cell cycle-dependent interference in transcript processing by the consensus octameric cycling sequence (CAUAGAAG) as a mechanism contributing to cell cycle-regulated expression of a mitochondrial histone-like protein (KAP3) in C. fasciculata (1). There are only a few reports of regulating gene expression through trans-splicing and polyadenylation mechanisms. However, this may be due to the fact that pre-mRNA transcripts that are not trans spliced or polyadenylated properly undergo rapid degradation by the cellular RNA degradation machinery and are not easily detected. Sequences present in the intergenic regions of the Leishmania chagasi gp63 gene family are known to regulate stage-specific expression of the gp63 gene (34). Also, regulatory sequences in the intergenic regions of the Leishmania mexicana cysteine protease B gene family have been shown to regulate expression of the CPB genes by affecting the trans-splicing mechanism (5). Since the trans-splicing and polyadenylation mechanisms in these organisms are tightly coupled, a model was proposed earlier, whereby a trans-acting factor(s) associates with cis-regulatory sequences and interacts with the trans-splicing and polyadenylation machinery to regulate polycistronic pre-mRNA processing (5). Our present evidence for in vivo binding of RBP45 to target messages containing cycling sequences, in addition to the identification of RBP63 as a PABP, suggests the involvement of a similar mechanism. At present there is no evidence for the interaction of CSBP II complex with the splicing machinery. However, the presence of an additional 73-kDa protein in the purified CSBP II that does not bind to RNA is noteworthy, and its identification and characterization may provide additional insights (27). It is also interesting that the hexamer core of the cycling sequence (AUAGAA) is complementary to the spliced leader conserved region (17). Defining the protein-protein and protein-RNA interactions in more detail will be required to understand this particular mechanism of gene regulation.
.
This research was supported by NIH grant GM53254.
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2010 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»