Previous Article | Next Article ![]()
Eukaryotic Cell, August 2004, p. 944-954, Vol. 3, No. 4
1535-9778/04/$08.00+0 DOI: 10.1128/EC.3.4.944-954.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.
Aline Pic-Taylor,1,
Simon K. Whitehall,1 Kate A. Martin,1 Jonathan B. A. Millar,2 Janet Quinn,1 and Brian A. Morgan1*
Institute of Cell and Molecular Biosciences, Faculty of Medical Sciences, University of Newcastle upon Tyne, Newcastle upon Tyne NE2 4HH,1 Division of Yeast Genetics, National Institute for Medical Research, London NW7 1AA, United Kingdom2
Received 27 January 2004/ Accepted 27 April 2004
|
|
|---|
|
|
|---|
In eukaryotes the periodic expression of genes plays an important role in the regulation of the cell division cycle. Global approaches in the budding yeast Saccharomyces cerevisiae have provided insight into the groups of genes that are expressed in this manner and also the transcription factors responsible for this cell cycle-dependent expression (10, 44, 47). The MBF (MluI binding factor), consisting of Mbp1 and Swi6, and the related SBF (Swi4/Swi6 cell cycle box binding factor), consisting of Swi4 and Swi6, transcription factor complexes are important for regulation of genes that are expressed early in the cell division cycle (see reference 51 for a review). In contrast, the forkhead proteins Fkh1 and Fkh2 regulate cell cycle-dependent expression of a group of genes, named the CLB2 gene cluster, that includes CLB1 and CLB2, encoding mitotic cyclins (18, 48), in the G2 and M phases (28, 29, 40, 53). Regulation of the CLB2 gene cluster involves the formation of a ternary complex between Fkh2 and the MADS-box protein, Mcm1, and the coactivator Ndd1 (28, 29, 40, 53; see references 8, 17, and 25 for reviews). The altered expression of the CLB2 gene cluster in a fkh1
fkh2
mutant is associated with defects in the structure of the mitotic spindle, nuclear migration, cell morphology, and cell separation. Recently, a single homologue of FKH1 and FKH2, CaFKH2, was identified in the pathogenic yeast Candida albicans and was shown to play a role in cellular morphogenesis (6). Moreover, the levels of several RNAs that were apparent homologues of genes regulated by Fkh1 and Fkh2 in S. cerevisiae were also affected in a CaFKH2 mutant (6).
In many cases, the molecular details underlying the cyclical transcriptional changes that occur during the cell division cycle are poorly understood. However, recent studies have revealed that the temporal activation of the Mcm1-Fkh2-Ndd1 complex involves a forkhead-associated (FHA) domain located in Fkh2. FHA domains act as phosphothreonine binding motifs that participate in regulated protein-protein interactions (reviewed in reference 15). Cell cycle-dependent phosphorylation of Ndd1 by the Cdc28-Clb2 cyclin-dependent kinase (Cdk) complex promotes interaction with the FHA domain of Fkh2 (13, 41). Fkh2 is also phosphorylated in a cell cycle-dependent manner, but the role of this modification in regulation is unknown (40).
Comparative studies between S. cerevisiae and the distantly related yeast Schizosaccharomyces pombe allow the identification of conserved mechanisms of cell cycle control. In S. pombe a transcription factor complex, MBF (DSC1), related to MBF in S. cerevisiae, that is composed of Res1/Sct1 (9, 50), Res2/Pct1 (35, 54), Rep2 (37), and Cdc10 (33), is responsible for periodic expression early in the cell division cycle. Interestingly, a forkhead transcription factor, Sep1, has also been linked to the regulation of the cell division cycle of S. pombe. In particular, sep1 mutants display defects in cell shape and cell separation (42, 45). Moreover, Sep1 is involved in regulating the periodic expression of the cdc15+ gene in the M and G1 phases (55). Recently, Anderson et al. identified a sequence element in the promoters of several genes including cdc15+ and spo12+, termed a PCB element, that confers M- and G1-phase-specific transcription (3). Furthermore, a transcription factor complex, termed PBF, whose components have not been identified, was found to bind to the PCB element. It was possible that PBF contained Sep1, but no link could be established (3).
To elucidate the mechanisms of cell cycle control of gene expression in S. pombe, we have searched the genome sequence for potential homologues of Fkh1 and Fkh2 in S. cerevisiae. Four potential forkhead-encoding genes were identified, of which two, sep1+ (see above) and mei4+, have been previously characterized. Mei4 is a meiosis-specific transcription factor which regulates the expression of the spo6+ gene (23). However, the remaining two potential forkhead-encoding genes had not been previously characterized. One of these, the open reading frame SPAC1142.08, encodes a protein with strong similarity to Fh11 from S. cerevisiae, which has been linked to the control of RNA processing, possibly by influencing the expression of genes involved in this process (14). Interestingly, the second of these, the open reading frame SPBC16G5.15c, encodes a protein that has the strongest similarity to Fkh2 of S. cerevisiae, suggesting that it may be involved in regulation of the cell division cycle. Based on this homology, we have named SPBC16G5.15c the fkh2+ gene. In this study we examined the potential role of Fkh2 in the regulation of the cell division cycle of S. pombe. We found that the fkh2+ gene is periodically expressed, with a timing similar to that of the Cdc10-regulated gene cdc18+. However, the cell cycle-dependent expression of fkh2+ occurs independently of Cdc10. We also demonstrated that alterations of the levels of Fkh2 in S. pombe cause growth defects in several cell cycle processes, similar to those observed in an fkh1
fkh2
mutant of S. cerevisiae. Consistent with these phenotypes, we found that Fkh2 is important for cell cycle-dependent gene expression in the M and G1 phases. Moreover, the Fkh2 protein was found to be regulated at the posttranslational level by cell cycle-dependent phosphorylation and by the alteration of protein levels. Collectively, these data suggest that cell cycle events in very distantly related organisms are regulated by a conserved class of forkhead transcription factor.
|
|
|---|
All S. pombe strains were grown at 30°C unless otherwise stated. Standard procedures for transformation and growth media were used (1, 36). YE5S medium was used for nonselective growth, and minimal EMM medium was used for selective growth.
To delete the fkh2+ gene, a ura4+ disruption cassette, obtained by PCR using the oligonucleotide primers PFkh2-1 (CCGTGAACCGCTGGCAACCGGAAGGGTAAACGAATGTTGGACAACCAACAAACGAGTGTAAATAAACACACACCAACAGCACAATTGCTGTAGAAAGGCTTAGCTACAAATCCCACT) and PFkh2-2 (CCGTTTGCACAAGAATAGGTCAAAGTCGAAAATAATTAAATTTCGAAGATCATAAGAGTGGGAGAGGGATAAGATATTAAACAAGGTGAATTTGTTGGAACACCAATGTTTATAACCAAG) andplasmid pREP42 (4) as template was introduced into the 428/429 diploid. The heterozygous fkh2+/
fkh2 diploid was then sporulated, and
fkh2 haploids were obtained.
Strain RB1, expressing a version of the Fkh2 protein that was tagged at the C terminus with 3xPkC epitopes from the normal chromosomal locus, was created by introducing pREP42-f2Pk linearized with NdeI into cdc25-22 cells. Ura+ colonies were isolated, and tagging was confirmed by PCR and Western blotting.
Plasmids.
To create pREP41MNHfkh2+, the fkh2+ gene was amplified from genomic DNA isolated from CHP429 with oligonucleotide primers Spfkh2-7 (ACGCATGTCGACTATGACTGTTCGCAGACTCG) and Spfkh2-8 (ACGCATGTCGACTTAAGCACTACTTTTAACATTAG), digested with SalI, and ligated into SalI-digested pREP41MNH vector (12). To create pREP42-f2Pk, the C-terminal
800 bp of the fkh2+ gene was amplified from genomic DNA isolated from CHP429 using oligonucleotide primers P1PK (AAAACTGCAGTCCTAAAGATGTGGGCTCACC) and P2PK (CGCGGATCCAGCACTACTTTTAACATTAGATTG). The PCR product was then digested with BamHI and PstI and ligated with BamHI- and PstI-digested pREP42PkC (46).
Cell synchronization. Cells containing the cdc25-22 allele were synchronized at the G2/M transition by shifting a mid-log-phase culture from 25°C (permissive temperature) to 36-37°C (nonpermissive temperature) for 3 to 4 h. The cultures were then shifted back to 25°C, and the growth rate and percent septation were analyzed. Alternatively, cultures were synchronized in early S phase by hydroxyurea (HU) treatment based on a previously described approach (52). HU was added (final concentration, 11 mM) to mid-log-phase cultures growing in YE5S. After a 2.5-h incubation, the cells were collected by filtration, washed with fresh medium, and finally resuspended in fresh YE5S. For fluorescence-activated cell sorter analysis, the cells were stained with propidium iodide as described previously (49). The DNA content of stained cells was then analyzed using a FACScan machine (Becton Dickinson FACScan).
Protein extraction and Western blot analysis.
Protein extracts were made essentially as previously described (46), using lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.5% Nonidet P-40, 10 mM imidazole, 0.1% leupeptin, 0.1% pepstatin A, 1% aprotinin, 1% phenylmethylsulfonyl fluoride, 0.2% Na3VO4, 5% NaF). For samples which were to be phosphatase treated, Na3VO4 and NaF were left out of the lysis buffer. These samples were then treated with 400 U of
phosphatase (NEB) for 15 min at 37°C prior to Western blot analysis. Protein extracts were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis SDS-PAGE and analyzed by Western blotting using the Pk antibody (Serotec).
RNA isolation and Northern analysis.
RNA was isolated and Northern blotting was performed as described previously (19). Gene-specific probes (PCR-generated fragments or restriction fragments) were labeled with [
-32P]dCTP (3,000 Ci/mmol). The invariant his3+ transcript was used as a loading control. The oligonucleotide primer pairs for specific gene probes were as follows: cdc15+, Cdc15-F (CTTCTATTGAGCGTGAGTACG) and Cdc15-B (GTGATGATACAACTTCCGATG); htb1+, H2B-Fwd (CGGTAAGGCTCCTAGGGATACC) and H2B-Rev (GTGCGATTCGCTTACTGAGC); spo12+, SPO12-N1 (ATTCAGAATTCATATGTCAGAAACTCAAGCTGACTC) and SPO12-C1 (TTACAGAGCTCGGATCCTATTCTTTTTCTGTCTGGA), respectively. The cdc18+ and his3+ gene-specific probes have been described previously (5), and the fkh2+ gene-specific probe was the SalI-digested PCR product generated using oligonucleotide primers Spfkh2-7 and Spfkh2-8 (see above). Probed membranes were autoradiographed with Fuji medical X-ray film. Membranes were quantified using a phosphorimager (bio-imaging analyzer Fujifilm Bas-1500) and Tina 2.0 software (Raytest).
Light and fluorescence microscopy. Unfixed cells were observed by light microscopy using a Zeiss Axioscope fluorescence microscope set up for differential interference contrast (DIC) with a 63x oil immersion objective and Axiovision digital imaging system.
Immunofluorescence of microtubules was carried out essentially as described previously (20). A 1:15 dilution of TAT1 antibody (Cancer Research UK) and a 1:50 dilution of fluorescein isothiocyanate (FITC)-conjugated anti-mouse secondary antibodies (Sigma) were used as specified by the manufacturers. Nuclei were observed by first spreading cells onto polylysine-coated slides, which were allowed to dry. The slides were then incubated in ice-cold methanol for 6 min and ice-cold acetone for 30 s, allowed to air dry, and finally mounted with VECTASHIELD mounting medium (Vector Laboratories Inc.) containing 4',6-diamidino-2-phenylindole (DAPI; Sigma). To view septa, calcofluor white (Sigma) was added to cultures at a final concentration of 1 mg/ml and the cultures were incubated for 5 min at room temperature. The cells were then washed twice with water, and 5 µl of cell suspension was then spotted onto polylysine-coated slides and allowed to dry. The slides were treated with methanol and then acetone and finally mounted as described above. DAPI-, calcofluor- and FITC-treated cells were visualized by excitation at
365 nm (DAPI and calcofluor) or 450 to 490 nm (FITC) under a Zeiss Axioscope fluorescence microscope with a 63x oil immersion objective and Axiovision digital imaging system.
|
|
|---|
![]() View larger version (51K): [in a new window] |
FIG. 1. Fkh2 is important for normal growth of S. pombe. (A) Schematic representation of Fkh2 (SPBC16G5.15c) in S. pombe and Fkh1 and Fkh2 in S. cerevisiae. The positions of the predicted FKH and FHA domains are indicated. (B and C) Comparisons of the predicted FHA (B) and FKH (C) domains of Fkh2 from S. cerevisiae (Sc) and Fkh2 from S. pombe (Sp). Identical amino acids are indicated by asterisks. Invariant amino acids in FHA domains are indicated in bold type. (D) fkh2+/ fkh2 heterozygous diploid cells were sporulated, and the resulting tetrads were dissected onto YE5S medium. Plates were photographed after 5 days of incubation at 30°C. (E) Dilutions of mid-log-phase cultures (5 µl) of the wild-type (CHP429) and fkh2 haploid strains were plated on YE5S medium and incubated at 23, 30, or 37°C for 3 days. (F) Serial dilutions (10-fold) of mid-log-phase cultures of the wild-type strain (CHP429) and two independent fkh2 haploid strains were plated on YE5S medium (control) and YE5S medium containing 15 µg of thiabendazole (TBZ) per ml and incubated at 30°C for 10 days. (G) fkh2 cells display aberrant microtubule structures. Cells of the wild-type (NT5) and fkh2 strains were grown to mid-log phase in YE5S medium. Microtubules and nuclei were visualized by immunofluorescence using the TAT1 antibody and FITC-conjugated secondary antibody (microtubules) and DAPI staining (nuclei), respectively. Some examples of aberrant fkh2 cells are shown.
|
fkh2 haploids revealed that deletion of the fkh2+ gene affects cell growth (Fig. 1F, control plate and data not shown).
fkh2 cells were also found to be cold sensitive and temperature sensitive (Fig. 1E) and demonstrated increased sensitivity to thiabendazole, a drug that destabilizes microtubules, causing damage to the mitotic spindle (Fig. 1F). These data suggest that the fkh2+ gene is important for normal cell growth and is required for the function of the mitotic spindle. Indeed, aberrant microtubule structures and nuclear organization were detected within a proportion of
fkh2 cells (Fig. 1G and data not shown). Interestingly, further analysis of
fkh2 mutant cells revealed that a large proportion (
80%) display other aberrant phenotypes. Some examples include branched cells with phenotypes such as fragmented DNA and/or multiple septa (Fig. 2A, panel 1), cells containing misplaced nuclei (panel 2), misshapen cells with phenotypes including multiple septa and/or multiple nuclei (panel 3), and cells that were abnormally small and round (panel 4).
![]() View larger version (60K): [in a new window] |
FIG. 2. Fkh2 is involved in several cell cycle-dependent processes. (A) Cells of mid-log-phase cultures of fkh2 (panels 1 to 4) and wild-type (CHP429; panel control) strains were analyzed by DIC and fluorescence microscopy (DAPI staining for nuclei [dotted arrows] and calcofluor staining for septa [solid arrows]). Several different abnormal phenotypes were observed, and some examples are shown. 1, branched cells with phenotypes such as fragmented DNA and/or multiple septa; 2, cells containing misplaced nuclei; 3, misshapen cells with phenotypes including multiple septa and/or multiple nuclei; 4, cells that were abnormally small and round. (B) Cells of a mid-log-phase culture of the CHP429 wild-type strain containing pREP41MNHfkh2+ (panels 1 to 4) or pREP41 vector (panel control) were grown in EMM medium in the absence of thiamine for 48 h and then analyzed by DIC and fluorescence microscopy (DAPI staining for nuclei [dotted arrows] and calcofluor staining for septa [solid arrows]). Several examples of phenotypes observed in the fkh2 mutant are shown.
|
fkh2 cells. Some examples of similar phenotypes are shown in Fig. 2B. Taken together, these data suggest that Fkh2 regulates several cell cycle-dependent processes including septum formation and the function of the mitotic spindle.
Fkh2 affects cell cycle-dependent gene expression.
Previously, the expression of several genes such as cdc15+ and spo12+ was shown to be coordinately expressed in the M and G1 phases in S. pombe (43). In contrast, genes such as cdc18+ are expressed in G1 whereas genes such as those encoding histones are expressed later in the cell division cycle in the S phase. We next examined whether we could detect a role for Fkh2 in cell cycle-dependent gene expression. To obtain RNA from synchronized cells, we attempted to construct a
fkh2 cdc25-22 strain. However, this was unsuccessful, indicating that this combination of mutant alleles is synthetically lethal, further emphasizing the connection between Fkh2 activity and the cell division cycle (data not shown). It was also impractical to use centrifugal elutriation to synchronize cultures of the
fkh2 mutant, since loss of Fkh2 function causes multiple defects in cell size and shape (Fig. 2A). Hence, to obtain RNA from synchronized cells, wild-type (CHP429) and
fkh2 mutant strains were blocked at S phase by using HU and RNA was isolated at various times after release from the block (52) (Fig. 3A). Cell synchrony was confirmed by fluorescence-activated cell sorter analysis (Fig. 3B). In wild-type cells, levels of cdc18+ RNA were high at the block and then rapidly dropped before peaking at 120 min. In contrast to cdc18+, peak expression of htb1+, encoding histone H2B, occurred during S phase following the peak of cdc18+ expression, and, in agreement, htb1+ RNA levels were high at several time points after the release of wild-type cells from the HU block and did not peak again until 140 min (Fig. 3A and C). Furthermore, cdc15+ and spo12+ RNA levels were low at the HU block in wild-type cells and then increased after the inhibition of htb1+ expression following release from the block, consistent with the periodic expression of the cdc15+ and spo12+ genes in the M and G1 phases (Fig. 3A and C). It is difficult to assess the synchrony of cultures of the
fkh2 mutant since many of the cells were abnormal (Fig. 1 and 2). However, our fluorescence-activated cell sorter analysis suggested that the majority of
fkh2 cells were arrested by HU (Fig. 3B). In
fkh2 cells the levels of cdc18+ and htb1+ RNA at the HU block, and the kinetics of induction and inhibition of these genes in the first cycle following release from the HU block, displayed profiles similar to those observed in wild-type cells (Fig. 3C and E). However, consistent with reduced synchrony following release from the HU block, the amplitude of these changes in
fkh2 cells was not as great as that of the changes observed in wild-type cells (Fig. 3C). Furthermore, the induction of cdc18+ and htb1+ RNA levels in the second cycle was delayed in comparison with that in the wild type (Fig. 3C), consistent with the slower growth of
fkh2 cells (Fig. 1). These studies are consistent with previous analysis of cell cycle-dependent gene expression in a fkh mutant strain of S. cerevisiae (53). Hence, although the phenotypes associated with
fkh2 cells prevented other analyses of synchrony, these data suggest that the loss of Fkh2 function does not affect the expression of htb1+ and cdc18+ (Fig. 3C and E). In contrast to cdc18+ and htb1+, the expression of the cdc15+ and spo12+ genes was aberrant in
fkh2 cells (Fig. 3C to E). In particular, RNA levels of cdc15+ and spo12+ were very much increased at the HU block (Fig. 3D and E), in contrast to cdc18+ and htb1+ (Fig. 3E). Furthermore, the expression of cdc15+ and spo12+ appeared to have lost normal cell cycle periodicity (Fig. 3C and D). Collectively, these data suggest that Fkh2 is required for both activation and repression of periodic expression during the cell division cycle and are consistent with the link between Fkh2 function and several cell cycle processes.
![]() View larger version (31K): [in a new window] |
FIG.3. Fkh2 affects cell cycle-dependent gene expression. (A) Northern blot analysis of RNA isolated from cells of the wild-type (CHP429) and fkh2 strains that had been synchronized with HU at S phase. Cell pellets were collected every 20 min following release from the HU block. RNA levels of cdc15+, spo12+, cdc18+, htb1+, and his3+ were examined with gene-specific probes. (B) The DNA content of HU-synchronized wild-type and fkh2 cells was analyzed by flow cytometry. Samples from mid-log-phase cultures of both strains (ML) were included as controls to allow analysis of the degree of synchronization by HU. (C to E) RNA levels were quantified relative to the his3+ invariant loading control. (C) The fold induction of RNA levels was calculated relative to the time-zero sample of each individual strain. (D) As RNA samples were analyzed on the same membrane in panel A, RNA levels were calculated relative to time zero of the wild-type strain which was set at unity. (E) Comparisons of RNA levels, quantified as described for panel D, at the HU block at time zero.
|
![]() View larger version (39K): [in a new window] |
FIG. 4. fkh2+ expression is regulated during the cell division cycle. The figure shows the results of a Northern blot analysis of RNA isolated from cells of the cdc25-22 strain that had been synchronized at the G2/M phase transition and then returned to 25°C. Cells were harvested every 15 min following the return to 25°C, and cell synchrony was determined by counting individual cell septa. RNA levels were examined with the indicated probes. To examine cell cycle-dependent changes in RNA levels, the data were quantified relative to the his3+-invariant loading control and the fold induction was calculated relative to the time-zero sample.
|
![]() View larger version (17K): [in a new window] |
FIG. 5. The cell cycle-dependent expression of fkh2+ is independent of Cdc10 function. The figure shows the results of a Northern blot analysis of RNA isolated from cells of the wild-type (CHP429) and cdc10-C4 strains that had been grown to mid-log phase at 25°C and then placed at 35°C for 0, 30, or 60 min. RNA levels were examined with the indicated probes. The RNA levels were quantified relative to the his3+-invariant loading control, and the fold induction was calculated relative to the time-zero sample of the wild-type strain.
|
Fkh2 is regulated during the cell division cycle. Our data indicate that Fkh2 activity is important for cell cycle-dependent gene expression. Furthermore, the effect of loss of Fkh2 on cdc15+ and spo12+ expression suggests that Fkh2 functions throughout the cell division cycle to regulate these genes. Consistent with these results, indirect-immunofluorescence analysis of the cellular location of 3xPkC-tagged Fkh2, expressed from the normal chromosomal locus, demonstrated that the protein is present in the nucleus of cells at all stages of the cell division cycle (data not shown).
To examine whether the mobility and/or levels of the Fkh2 protein were regulated during the cell division cycle, a cdc25-22 strain (RB1) was constructed that expressed 3xPkC-tagged Fkh2 from the normal chromosomal locus. Western blot analysis of extracts isolated from cells of the RB1 strain and an untagged control strain revealed the presence of specific bands of the predicted mobility for tagged Fkh2 (Fig. 6 and data not shown). An exponentially growing culture of RB1 was synchronized at the G2/M transition, and protein extracts were obtained every 15 min following shift of the culture to the permissive temperature (25°C). Western blot analysis, using the anti-Pk antibody, revealed that slower-mobility forms of Fkh2 were present at different times during the cell division cycle. The slowest-mobility bands were present up to 45 to 60 min following release, prior to the peak of septation (Fig. 6A). Slower-mobility bands then reappeared between 135 and 180 min (Fig. 6A). Our RNA analysis demonstrated that Fkh2 was involved in the regulation of cdc15+ and spo12+ expression during the cell division cycle (Fig. 3). Importantly, we found that the appearance of these slower-mobility shifts in Fkh2 correlated with increased expression of cdc15+, suggesting that they may be linked to the regulation of gene expression (Fig. 6B).
![]() View larger version (27K): [in a new window] |
FIG. 6. The Fkh2 protein is regulated during the cell division cycle. (A) Western blot analysis using the anti-Pk antibody of extracts isolated from cells of RB1 (cdc25-22 fkh2+::3xPkC) synchronized at the G2/M phase transition and then returned to 25°C. Cells were harvested every 15 min following the return to 25°C, and cell synchrony was determined by counting individual cell septa. Slower-mobility forms of Fkh2 are indicated. (B) Northern blot analysis of RNA isolated from cells of the RB1 (cdc25-22 fkh2+::3xPkC) strain synchronized at the G2/M phase transition and then returned to 25°C. Cells were harvested every 15 min following the return to 25°C, and cell synchrony was determined by counting individual cell septa. RNA levels of cdc15+ and fkh2+ were examined with gene-specific probes and were quantified relative to the his3+-invariant loading control. Fold induction was calculated relative to the time-zero sample. (C) Protein extracts, isolated at 30 min following synchronization, were either untreated or treated with phosphatase and analyzed by Western blotting using the anti-Pk antibody. Slower-mobility forms of Pk epitope-tagged Fkh2 that are present in the absence of phosphatase are indicated. Loading was determined by copper staining of a nonspecific band (loading control).
|
It is likely that the cell cycle-dependent alteration in the mobility of Fkh2 represents posttranslational modification(s). To test whether any of these modifications were caused by phosphorylation, a protein sample containing slower-mobility forms of Fkh2 was treated with
phosphatase (Fig. 6C). This treatment was found to resolve the Fkh2 protein back to faster-mobility forms of the protein, revealing that several of the slower-mobility forms were likely caused by phosphorylation.
Thus, we have identified a forkhead protein, Fkh2, that is involved in the regulation of several processes during the cell division cycle. Furthermore, Fkh2 is modified by phosphorylation in a cell cycle-dependent manner, with a timing suggesting that this is important for regulating gene expression.
|
|
|---|
The periodic expression of cdc18+ is regulated by the MBF (DSC1) transcription factor complex, suggesting that fkh2+ expression was also regulated by this complex. However, fkh2+ expression is not dependent on the activity of Cdc10, which is a component of MBF (DSC1) (33). These data suggest the presence of an unidentified transcription factor(s) that regulates periodic expression early in the cell division cycle.
The Fkh2 protein in S. cerevisiae is a critical component of Swi Five Factor (SFF), which forms a ternary complex with the MADS-box protein Mcm1 to regulate the CLB2 cluster of genes in the G2 and M phases (28, 29, 40, 53). In addition, a closely related forkhead protein, Fkh1, acts to regulate the cell division cycle independently of Mcm1 (7, 21). Fkh2 in S. pombe is most closely related to Fkh2 and also Fkh1 in S. cerevisiae. Consistent with this relationship, we found that similar cell cycle processes (Fig. 1 and 2) were defective in
fkh2 cells of S. pombe and fkh1
fkh2
cells of S. cerevisiae. In S. cerevisiae, these phenotypes have been linked to deregulated expression of the CLB2 gene cluster. Our characterization of a
fkh2 mutant of S. pombe indicated that Fkh2 also functions to regulate late cell cycle-dependent gene expression. We demonstrated that deletion of the fkh2+ gene resulted in the loss of activation and repression of periodic expression of the cdc15+ and spo12+ genes in the M and G1 phases. S. cerevisiae and S. pombe are very divergent in evolution. Hence, the observation that forkhead proteins play a role in similar cell cycle processes in these yeasts strongly suggests that this is a key function of these proteins in eukaryotes.
We investigated possible mechanisms of regulation of Fkh2 activity during the cell division cycle. Both fkh2+ mRNA and protein levels change in a cell cycle-dependent manner, suggesting that the levels of Fkh2 are important for normal cell cycle progression. Furthermore, the expression of the fkh2+ gene from a heterologous promoter causes cell cycle defects. However, alteration of protein levels is likely not the only form of regulation of Fkh2. The Fkh2 protein could be detected in the nucleus at all stages of the cell division cycle. Moreover, our data suggested that Fkh2 was phosphorylated on multiple sites in a cell cycle-dependent manner, with the peak of phosphorylation coinciding with increased levels of cdc15+ expression. Given the effects of loss of Fkh2 activity on cdc15+ and spo12+ expression, it is tempting to speculate that phosphorylation of Fkh2 regulates repressor and/or activator functions of the protein. Which kinase(s) is responsible for this phosphorylation? We have found that in S. cerevisiae the Cdc28 Cdk in association with Clb cyclin phosphorylates Fkh2 (A. D. Sharrocks and B. A. Morgan, unpublished data). The timing of phosphorylation of Fkh2 in S. pombe is consistent with a role for the Cdc2 Cdk in association with the B-type cyclin Cdc13 (Fig. 7). Furthermore, we have identified several potential Cdk phosphorylation sites in Fkh2. Recently, Anderson et al. revealed that the polo-like kinase Plo1 was involved in the activation of expression of a group of genes in M and G1 phases, including cdc15+ and spo12+ (3). Thus, it is possible that Plo1 is also responsible for phosphorylation of Fkh2 (Fig. 7).
![]() View larger version (11K): [in a new window] |
FIG. 7. Fkh2 regulates gene expression in the cell division cycle. Fkh2 functions to regulate gene expression in the M and G1 phases of the cell division cycle, and this activity is correlated with cell cycle-dependent phosphorylation of Fkh2.
|
Recently, Anderson et al. identified a binding activity that bound to the promoters of several genes, including cdc15+ and spo12+, that are expressed in the M and G1 phases (3). Their analysis also identified a consensus binding site, which they named a PCB element, in these promoters. Interestingly, this sequence is related, although not identical, to the forkhead DNA binding consensus sequence to which forkhead proteins from higher eukaryotes bind (27). Previously, Sep1 was shown to play a role in the periodic expression of cdc15+ (55). However, PBF binding was unaffected in a sep1 mutant (3). Fkh2 affects cdc15+ and spo12+ expression and so it is possible that Fkh2 is a component of PBF. However, to date we have been unable to detect direct binding of Fkh2 to the cdc15+ promoter (data not shown). At present we cannot exclude the possibility that Fkh2 does not bind the cdc15+ promoter directly but, rather, regulates the expression of a transcriptional regulator of cdc15+. Studies of the components of PBF, and of the functions of Sep1 and Fkh2, are important for elucidation of the relationships between these proteins in regulating gene expression.
In summary, we have identified a transcription factor that regulates cell cycle-dependent gene expression in S. pombe. Furthermore, our data suggest that forkhead proteins play conserved roles in regulating cell cycle processes. Indeed, recent studies of metazoans have also linked forkhead proteins with the regulation of cell cycle-dependent gene expression (2). Therefore, it is likely that the elucidation of mechanisms of regulation of forkhead proteins in the cell division cycle of divergent yeasts will yield important insights into the regulation of these key proteins in eukaryotes.
The work was funded by Cancer Research UK.
R.B. and A.P.-T. contributed equally to this work. ![]()
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»