Eukaryotic Cell Visit the journal of Applied and Environmental Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McLeod, A.
Right arrow Articles by Fry, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McLeod, A.
Right arrow Articles by Fry, W. E.
Eukaryotic Cell, February 2004, p. 91-99, Vol. 3, No. 1
1535-9778/04/$08.00+0     DOI: 10.1128/EC.3.1.91-99.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.

Core Promoter Structure in the Oomycete Phytophthora infestans

Adele McLeod,{dagger} Christine D. Smart, and William E. Fry*

Department of Plant Pathology, Cornell University, Ithaca, New York 14853

Received 24 January 2003/ Accepted 1 November 2003


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have investigated the core promoter structure of the oomycete Phytophthora infestans. The transcriptional start sites (TSS) of three previously characterized P. infestans genes, Piexo1, Piexo3, and Piendo1, were determined by primer extension analyses. The TSS regions were homologous to a previously identified 16-nucleotide (nt) core sequence that overlaps the TSS in most oomycete genes. The core promoter regions of Piexo1 and Piendo1 were investigated by using a transient protoplast expression assay and the reporter gene ß-glucuronidase. Mutational analyses of the promoters of Piexo1 and Piendo1 showed that there is a putative core promoter element encompassing the TSS (–2 to + 5) that has high sequence and functional homology to a known core promoter element present in other eukaryotes, the initiator element (Inr). Downstream and flanking the Inr is a highly conserved oomycete promoter region (+7 to + 15), hereafter referred to as FPR (flanking promoter region), which is also important for promoter function. The importance of the 19-nt core promoter region (Inr and FPR) in Piexo1 and Piendo1 was further investigated through electrophoretic mobility shift assays (EMSA). The EMSA studies showed that (i) both core promoters were able to specifically bind a protein or protein complex in a P. infestans whole-cell protein extract and (ii) the same mutations that reduced binding of the EMSA complex also reduced ß-glucuronidase (GUS) levels in transient expression assays. The consistency of results obtained using two different assays (GUS transient assays [in vivo] and EMSA studies [in vitro]) supports a convergence of inference about the relative importance of specific nucleotides within the 19-nt core promoter region.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RNA polymerase II transcribes the majority of protein-coding genes in higher eukaryotes, where transcription is directed by DNA elements including the core promoter, a regulatory promoter, and linked enhancer sequences (7, 26). Core promoters typically are present within 40 to 50 nucleotides up- and downstream from the transcriptional start site (TSS). The core promoter determines the start site of transcription and directs assembly of the preinitiation complex, consisting of RNA polymerase II, the general transcription factors, and a mediator (50, 52). Immediately upstream of the core promoter is the regulatory promoter, and farther away are up- and downstream enhancer sequences (7, 43).

Core promoter elements have been characterized extensively in mammals, insects, and fungi. In these eukaryotes the best-defined core promoter elements include the TATA element, initiator element (Inr), TFIIB recognition element (BRE), and downstream promoter element (DPE) (6, 7, 24). These core promoter elements can be present either individually or in different combinations (6, 35).

The Inr was first characterized in 1989 in metazoans as a defined core promoter element that overlaps the transcriptional start site of some genes (46). Subsequently, the Inr has also been characterized in Drosophila, Trichomonas, and plants (4, 28, 34). The Inr can direct accurate transcription in the absence of any other core promoter element or can function cooperatively with either a TATA box and/or the DPE element (17, 41, 47).

We are interested in the oomycetes because they are a group of eukaryotes that include important pathogens of plants, animals, and insects in addition to saprophytes (1). Although oomycetes have a fungus-like growth, both phylogenic and phenotypic analyses have shown that they are not fungi but belong to the kingdom Chromista (8, 49).

Very little is known about transcription initiation of protein-coding genes in the kingdom Chromista, which includes a group of diverse organisms such as brown algae and diatoms. In oomycetes only one core promoter element has been characterized; it is in the piypt1 gene of Phytophthora infestans. This promoter contains a 17-bp CT-rich element that is important for transcription. It has an Inr-like element (CTCCTTCT) at the 5' region, 24 bp upstream from the TSS. However, the functional significance of this putative Inr-like element, not present in any other known oomycete gene, is unclear (9). In contrast, a highly conserved 16-nucleotide (nt) putative core promoter element is present at the TSSs of almost all known oomycete genes (40). Other than sequence conservation, the functional significance of this element is unknown and has not been investigated. Oomycete core promoter regions are further characterized by the absence of canonical TATA elements (18).

In this study we have investigated the core promoter structure of two putative ß-1,3-glucanase genes, Piexo1 and Piendo1, from the oomycete P. infestans. The expression of Piexo1 is regulated during development, being highly expressed in mycelia and sporangia, but not in zoospores and germinating cysts. Piendo1 is also differentially regulated, being expressed in mycelia, sporangia, and germinating cysts but not in zoospores (32). We have studied the promoter regions (sequence upstream from the start ATG) of these two genes by using a transient protoplast expression system. Sites that were detected as important in the transient assays were further investigated by electrophoretic mobility shift assays.


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Primer extension analyses. The TSSs of three previously characterized P. infestans genes, Piexo1, Piexo3 and Piendo1 (32), were determined by primer extension analyses. P. infestans RNA was isolated from mycelia grown for 10 days in pea broth (14) by using a hot phenol method (37). The extracted RNA was DNase treated according to the manufacturer's instructions (Invitrogen Corporation, Carlsbad, Calif.). Primer Ext-exo1 (TCCATGGAGATGGACTGGCGG) was used for primer extension analysis of Piexo1, primer Ext-exo3 (AACGTCATCCAGTGCTCAGCGACG) was used for Piexo3, and primer Ext-endo1 (CGGCGCGGATGTTGTAGTTGATGC) was used for Piendo1. Primers (1 pmol each) were end labeled and annealed to 60 µg of total RNA in 1x first strand buffer (Invitrogen Corporation) at 58°C for 30 min. The mixture was heated for 5 min at 65°C prior to annealing. After primer annealing, Superscript II RNase Hreverse transcriptase (400 U) (Invitrogen Corporation), deoxynucleoside triphosphates (20 mM each), RNAseOut (Invitrogen) (80 U), and dithiothreitol (DTT) (800 mM) were added in a total volume of 40 µl. Primer extension was done at 42° for 1 h. The reaction mixture was ethanol precipitated and loaded onto a 8% denaturing polyacrylamide gel. Sequencing ladders of the three genes were obtained by using the fmol DNA cycle sequencing system according to the manufacturer's instructions (Promega). Primer extension analyses were repeated twice using independent RNA extractions.

Comparison of oomycete core promoter regions. A literature search revealed that the TSS has been reported for only 15 oomycete genes (in species of Phytophthora, Bremia, and Achlya). The sequences of the 5' untranslated regions of these genes, as well as those of Piexo1, Piexo3, and Piendo1, were investigated. The sequences surrounding the TSSs of all these genes were compared by alignment. The previously identified conserved 16-nt core sequence that encompasses the transcriptional start site of oomycete genes was used as a reference point (40). We also searched for the 16-nt core sequence in the upstream regions of 18 oomycete genes (Phytophthora, Achlya, and Saprolegnia) for which the TSSs have not been determined.

Construction of reporter plasmids. Plasmids containing Piexo1 promoter-ß-glucuronidase(GUS) (pEXO) and Piendo1 promoter-GUS (pENDO) transcriptional fusions were constructed using plasmid pHAMT35G, kindly provided by H. S. Judelson (University of California, Riverside). pHAMT35G is a pUC19-based vector which includes the 920-bp ham34 promoter of Bremia lactucae fused to the bacterial GUS gene (uidA) and the 550-bp ham34 terminator of B. lactucae (21). The ham34 promoter is flanked by HindIII and NcoI restriction sites in pHAM35G. The vectors pEXO and pENDO were constructed by exchanging the ham34 promoter in pHAM35G with the promoters (regions upstream from the translational start codon) of Piexo1 and Piendo1, using the HindIII and NcoI restriction sites. The promoter region of Piexo1 (993 bp) was PCR amplified using primers PP-EX1 (GCATGAAGCTTAATGACCACATCTTTAAA) and PP-EX2 (GTATGCCATGGTCTGCCTACAGATTCGAA). The promoter region (1 kb) of Piendo1 was amplified using primer PP-EN1 (GCATGAAGCTTAAAGAAATCCCAGCA) and primer PP-EN2 (ATACGCCATGGGTTTTCAATGTTCGAGATC). The introduced HindIII restriction sites in PP-EX1 and PP-EN1 and NcoI restriction sites in PP-EX2 and PP-EN2 are underlined. All PCRs were done as previously described (32). The promoter regions were amplified using Platinum TaqDNA Polymerase High Fidelity (Invitrogen Corporation) and an annealing temperature of 65°C. The structures of the constructs were verified by sequencing the 3' promoter and 5' GUS gene junction, as well as by restriction digestions with HindIII and NcoI.

Transformation procedure for obtaining stable P. infestans transformants. Transformants of P. infestans (strain SA960008) expressing pEXO or pENDO were obtained as previously described (20, 21). Cotransformation of 107 protoplasts was done using 70 µg of pEXO or pENDO and 30 µg of pHAM34N. Plasmid pHAM34N (kindly provided by H. S. Judelson) confers resistance to geneticin and was used as a selectable marker to select transformants. Plasmid DNA for transformation was isolated by using the Wizard Plus Maxiprep kit according to the manufacturer's instructions (Promega). P. infestans transformants containing pEXO and pENDO plasmids were selected by Southern analysis using the uidA gene as a probe (data not shown).

The TSSs of the Piexo1 promoter-GUS and Piendo1 promoter-GUS fusions were determined in stably transformed P. infestans transformants expressing the GUS gene driven by these promoters. Primer extension analyses and sequencing were done as described above, using primer GUS4 (GACTGAATGCCCACAGGCCGTCGAG).

Site-directed mutations in the core promoters of Piexo1 and Piendo1. Site-directed mutations within the full-length promoters of Piexo1 (993 bp) and Piendo1 (1 kb) were made using the QuikChange XL-Site Directed Mutagenesis kit according to manufacturer's instructions (Stratagene, La Jolla, Calif.). Polyacrylamide gel-purified oligonucleotides were synthesized by Integrated DNA Technologies (Coralville, Iowa). Plasmids pENDO and pEXO were used as template DNA (20 ng/50-µl reaction mixture). The introduction of mutations was confirmed by sequencing.

Construction of plasmids with deletions in the promoter of Piexo1. Plasmids containing 5' and 3' deletions in the promoter (993 bp) of Piexo1 were constructed by replacing the ham34 promoter in pHAM35G with PCR-amplified fragments of the promoter region of Piexo1, using NcoI and HindIII restriction sites. pEXO was used as the template in the PCRs. An annealing temperature of 65°C was used for all PCRs as described previously (32). The structures of the constructs were verified by sequencing the 3' promoter and 5' GUS gene junction, as well as by restriction digestions with HindIII and NcoI.

Construction of gain-of-function plasmids. The ability of plasmid pEXO(–6 to +69), containing 75 bp of the promoter region of Piexo1, to respond to upstream promoter regions was investigated. Two plasmids were constructed, pEXO(–431||+69) and pEXO(–924||+69). Plasmid pEXO(–431||+69) was constructed by PCR amplifying the –431 to –331 promoter region of Piexo1 from pEXO, using primers with HindIII restriction sites at the ends. The PCR product was digested with HindIII and ligated into the HindIII site of pEXO(–6 to +69), creating pEXO(–431||+69). Plasmid pEXO(–924||+69) was constructed in a similar way, except that the –924 to –431 promoter region of Piexo1 was ligated into pEXO(–6 to +69). The orientations of the ligated fragments were determined by sequencing.

P. infestans transient expression assay. The effects of mutations and deletions in the Piexo1 promoter-GUS (pEXO) and Piendo1 promoter-GUS (pENDO) plasmids were evaluated by using a P. infestans transient expression assay. Protoplast generation and transformation of P. infestans were done as previously described (20, 21). An equimolar amount (13 pmol) of each construct was tested in four independent experiments using 1 ml of protoplasts (107 protoplasts) per construct. Within each experiment two replicates of the relevant wild-type construct extracted from two independent plasmid preparations were included. The two wild-type replicates within each experiment were used to ensure that DNA uptake between different tubes within an experiment, consisting of 8 to 10 tubes containing 1 ml of protoplasts, were equal. Since the two replicate wild-type treatments within an experiment differed only by 10 to 15%, we were confident that (i) DNA quantification and isolation was not affecting GUS quantification and (ii) within an experiment DNA uptake was comparable among the 8 to 10 transformation tubes. The transformed protoplasts were regenerated for 22 h and harvested as described previously (20). Harvested protoplasts (1 ml) were resuspended in 200 µl of GUS extraction buffer (12) and frozen in liquid nitrogen. The thawed protoplast suspensions were lysed by sonication for 1 min in a sonicator bath followed by 1 min on ice. The sonication was repeated three more times, after which the lysate was spun for 2 min at a relative centrifugal force of 12,000. Protein concentrations of the supernatant were determined by using the Bradford reagent (Bio-Rad). For each construct 100 µl of supernatant was incubated with 100 µl of 2 mM 4-methylumbelliferyl ß-glucuronide at 37°C. The amount of product (4-methylumbelliferone [MU]) was measured after 1 h, using a fluorometer as described previously (12). The amounts of MU produced by the deletion and mutation plasmids were corrected for protein concentration and expressed as percentages relative to the amounts of MU produced by the corresponding wild-type plasmids (pEXO and pENDO) within each experiment.

Plasmid DNA for the transient expression assays was isolated by using the Wizard Plus Maxiprep kit according to the manufacturer's instructions (Promega). All constructs that gave relative GUS values of less than 50% relative to the wild-type plasmid were tested with two independent DNA plasmid preparations. This was done to ensure that reduced GUS levels seen in these mutated constructs were not due to bad plasmid quality or errors in DNA quantification. Transient expression assays using these independent DNA plasmid preparations gave similar relative GUS levels when compared to the wild-type construct in each of the four to six independent experiments.

Whole-cell P. infestans protein extraction. A whole-cell protein extract from P. infestans mycelia was prepared using a slightly modified method of Green et al. (16). P. infestans was grown for 7 days in pea broth. Harvested mycelia were rinsed with distilled water and then washed twice in cold phosphate-buffered saline. Approximately 12 g (wet weight) of mycelia was blended in 100 ml of cold buffer A (40 mM Tris-HCl [pH 7.5], 5 mM MgCl2, 0.5 M sucrose, 10 mM 2-mercaptoethanol, 0.8 mM phenylmethylsulfonyl fluoride [PMSF]), 10 µM leupeptin) in a prechilled Waring blender using five pulses of 10 s each at low speed. The homogenized mycelia were filtered through Miracloth (Calbiochem, LaJolla, Calif.). NaCl was added to the filtrate to a final concentration of 0.5 M. The filtrate mixture was gently agitated for 30 min at 4°C and then spun at 40,000 rpm in a Beckman L7-65 centrifuge (50.2 Ti rotor) for 1 h. Proteins in the supernatant were precipitated by adding 0.3 g of ammonium sulfate/ml and stirring at 4°C for 30 min. One-tenth milliliter of 1 M NaOH was added for each 10 g of ammonium sulfate added. The precipitated proteins were collected by centrifugation at 11,000 rpm for 25 min in a 20J Beckman rotor. The pellets were combined in 2.5 ml of buffer B (20 mM HEPES-KOH [pH 7.3], 40 mM KCl, 1 mM EDTA, 10% glycerol, 0.5 mM DTT, 0.8 mM PMSF, 10 µM leupeptin). The buffer was exchanged with buffer B, using a PD-10 desalting column according to manufacturer's instructions (Pharmacia Biotech, Piscataway, N.J.).

P. infestans electrophoretic mobility shift assay (EMSA). DNA-protein interactions were studied using double-strand oligonucleotides of Piexo1 (31 bp) and Piendo1 (36 bp) and a P. infestans whole-cell protein extract, according to standard procedures (7). Double-strand oligonucleotides were obtained by combining equimolar amounts of complementary oligonucleotides (see Fig. 5) followed by heating for 5 min at 90°C and 30 min at 55°C and then slow cooling to room temperature for 1 h. Double-strand wild-type oligonucleotides (see Fig. 5) were end labeled with [{gamma}-32P]ATP, using T4 polynucleotide kinase (Promega). Unincorporated label was removed by using P-30 microspin columns (Bio-Rad).



View larger version (37K):
[in this window]
[in a new window]
 
FIG.5. EMSAs using a P. infestans whole-cell extract and a promoter fragment of Piexo1 (a) and Piendo1 (b). Thirty-one-base-pair (Piexo1) and 36-bp (Piendo1) 32P-labeled double-stranded oligonucleotides were used in EMSAs with 24 µg of P. infestans whole-cell proteins. Competition assays were performed by using wild-type (WT) and mutant fragments. The complete sequences of the fragments are shown at the bottom of each panel, along with the relative percent GUS activities of constructs containing these mutations in a P. infestans transient protoplast assay. Mutations are indicated by bold lowercase letters. The locations of two regions, the Inr and FPR, are indicated above the sequence alignments. Lane 1, protein extract with 32P-labeled wild-type oligonucleotides; lanes 2 to 9, competition with 200 and 400x excess molar ratios of nonlabeled competitor fragments of Piexo1 wild-type and mutant oligonucleotides (a) and 50 and 100x excess molar ratios of nonlabeled competitor fragments of Piendo1 wild-type and mutant oligonucleotides (b). Lanes containing no protein extract are not shown.

 
The specificity of the DNA-protein interaction was determined by doing a competition binding assay. The binding reaction mixture consisted of 24 µg of P. infestans whole-cell proteins, 12 fmol of {gamma}-32P-labeled wild-type double-strand oligonucleotides, 100 ng of poly(dI-dC) · poly(dI-dC) (Pharmacia Biotech) per µl, 1.25 µg of bovine serum albumin/µl, 2 mM DTT, 50 mM MgCl2, 67 mM KCl, 13% glycerol, 12 mM HEPES-KOH [pH 7.3], 0.8 mM PMSF, and 10 µM leupeptin. The competition assays were performed with double-strand nonlabeled wild-type and mutant oligonucleotides at 200 and 400x molar excess concentrations for Piexo1 and at 50 and 100x molar excess concentrations for Piendo1. Binding was done on ice for 10 min using nonlabeled oligonucleotides, followed by addition of [{gamma}-32P]ATP-labeled wild-type oligonucleotides and another 20-min incubation on ice. The samples were loaded onto a 4.5% 0.5x Tris-borate-EDTA nondenaturing polyacrylamide gel, followed by electrophoresis at 300 V for 20 min at room temperature. Subsequently, the gels were dried and bands were visualized by PhosphorImager analyses (Molecular Dynamics Imaging System Storm 850). The band intensities were quantified by using the Molecular Dynamics Image quant version 5 software.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of the TSSs of Piexo1, Piexo3, and Piendo1. Primer extension analyses showed that the TSSs of Piexo1, Piexo3, and Piendo1 mapped to a conserved 16-nt core sequence, present at the TSSs of most oomycete genes (40). The primer extension product for all three genes consisted of only one band, which mapped to an adenosine residue within the 16-nt core (Fig. 1). The region upstream from Piexo1, Piexo3, and Piendo1 did not contain a conserved TATA element at approximately –30 from the TSS.



View larger version (71K):
[in this window]
[in a new window]
 
FIG. 1. Alignment of the TSS and putative TSS regions in oomycete genes. The genes for which the TSS is known are indicated by an asterisk, with nucleotides at the TSS underlined and in bold. The TSS regions of the genes without an asterisk are not known. The consensus sequence of a conserved 16-nt core sequence is located at the top of the alignment. Nucleotides matching this consensus sequence are highlighted in gray. The locations of a putative oomycete Inr and an FPR, within a 19-nt core sequence, are indicated by brackets. The adenosine residue within the Inr is designated as the +1 position. The TSS region of two well-characterized eukaryotic (metazoan and protist) Inr-containing genes is located at the bottom of the alignment. 1, genes from the oomycetes Phytophthora, Bremia, Achlya, and Saprolegnia. 2, number of nucleotides upstream from the translational start codon (ATG) and the +1 position in each aligned sequence. 3, GenBank accession number.

 
TSSs of Piexo1 and Piendo1 reporter plasmids in stable P. infestans transformants. Four P. infestans transformants expressing chimeric Piexo1 promoter-GUS (pEXO) and Piendo1 promoter-GUS (pENDO) reporter plasmids were obtained. The TSSs of these transformants, expressing the GUS gene driven by the promoter of either Piexo1 or Piendo1, mapped to the same adenosine residue that is used as the TSS in the native gene promoters (data not shown). This shows that transcriptional fusion of the promoters to the GUS gene, which introduced two cytosine residues at the 3' region of the promoter, did not alter the TSS in the promoter. This also indicates that cryptic sites in the vector were not used for transcription initiation.

Comparison of oomycete core promoter regions. The sequences surrounding the TSSs of Piexo1, Piexo3, Piendo1 and other published oomycete genes were compared to the previously identified 16-nt core consensus sequence (40). The TSS regions of Piexo1, Piexo3, and Piendo1 all have high homology to the conserved 16-nt core sequence (Fig. 1). However, sequence comparison of the genes and published oomycete genes with known TSSs showed that the 16-nt core consensus sequence (GCTCATTYYNCAWTTT, where Y = pyrimidine and W = A or T), identified by Pieterse et al. (40), extends at the 3' region up to position +15, forming a highly conserved 19-nt core sequence (Fig. 1). Within the 19-nt core consensus sequence (GCYCA+1TTYYNCAWTTTNYY) the first adenosine nucleotide is designated as +1 (Fig. 1). Investigation of the region upstream from the translational start codon in 18 oomycete genes (Phytophthora, Achlya, and Saprolegnia) for which the TSS has not been determined supported the presence of this highly conserved 19-nt core sequence (Fig. 1).

Further investigation of the 19-nt core and putative 19-nt core sequences of oomycete genes, including Piexo1, Piendo1, and Piexo3, showed that there is a sequence very similar to that of the Inr present in metazoan and Trichomonas promoter regions (Fig. 1). The putative oomycete Inr has a suggested consensus sequence of YCA+1TTYY. The putative Inr overlaps the known TSSs of the genes, and in most of the genes the initiation of transcription is at the adenosine residue within the putative Inr, indicated by +1 (Fig. 1).

Scanning mutational analysis of the promoter of Piexo1. The importance of the 16-nt core sequence present at –4 to +12 in Piexo1 was determined by first deleting this region from pEXO (Fig. 2, pEXO-delbox). Deletion of the 16-nt core sequence resulted in a severe reduction of promoter activity relative to the full-length wild-type promoter (Fig. 2, pEXO-delbox).



View larger version (46K):
[in this window]
[in a new window]
 
FIG. 2. Scanning mutational analyses of the P. infestans promoter Piexo1. The histogram shows the GUS activities of P. infestans protoplasts transformed with different mutated constructs of the full-length promoter of Piexo1. The sequence of the region in which mutations were introduced is shown to the left of the histogram. Mutations are indicated by lowercase letters, and the transcriptional start site is designated as A+1. There were no deletions in the promoters except where indicated by dashed lines. The activity of each mutated construct is shown as a percentage of the activity of the wild-type promoter (pEXO) and is the mean ± standard deviation of four independent experiments.

 
The importance of nucleotides in the –8 to +18 region of Piexo1 was determined by using scanning mutational analyses that introduced several two to four consecutive base pair mutations into the region (Fig. 2). Scanning mutational analyses revealed that bp –1 to +3 (pEXO*–1/+3) and bp +9 to +11 (pEXO*+9/+11) were very important for promoter function (Fig. 2). Furthermore, scanning mutational analyses suggested that the region directly downstream from the +9 to +11 region, at positions +13 to +15, is also important for promoter function (Fig. 2, pEXO*+13/+16 and pEXO*+14/+15).

Point mutational analyses in the putative Inr of Piexo1 and Piendo1. Scanning mutational analyses and sequence comparison showed that the region –1 to +5 contained a putative Inr that was important for promoter function (Fig. 1 and 2). To determine if nucleotides within the putative Inr were important for promoter function, point mutations were introduced into this region in pEXO and pENDO. The point mutational analyses showed that in both promoters the nucleotides at positions –1, +1, and + 3 were most critical for promoter function (Fig. 3a and b).



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 3. Point mutational analyses of the putative Inr and the region directly downstream from the Inr in two P. infestans promoters, Piexo1 and Piendo1. Histograms show the GUS activities of P. infestans protoplasts transformed with constructs pEXO (a) and pENDO (b) containing point mutations within the full-length promoters of Piexo1 and Piendo1. The sequence of the region into which mutations were introduced is shown to the left of the histograms. Mutations are shown in bold and lowercase, and the transcriptional start site is indicated by +1. The activity of each mutated construct is shown as a percentage of the activity of the wild-type promoter (pEXO and pENDO) and is the mean ± standard deviation of four independent experiments.

 
Mutational analyses of the region directly downstream from a putative Inr in Piexo1 and Piendo1. Scanning mutational analyses suggested that the region directly downstream from the putative Inr in Piexo1 is also important for promoter function (Fig. 2). Therefore, we further investigated the effect of point mutations in this region in the context of the full-length Piexo1 promoter. Point mutations were introduced at positions +9 to +12 in pEXO1 (Fig. 3a). Point mutations at positions +9, +10, and +11 resulted in a reduction of promoter activity to less than 50% of that of the wild type (Fig. 3a, pEXO*+9, pEXO*+10, and pEXO*+11).

To determine if the importance of the region directly downstream of a putative Inr is unique to Piexo1, we also investigated the importance of this region in Piendo1. Similar to Piexo1, mutations at bases +9 to +11 in the promoter of Piendo1 also resulted in a reduction of promoter activity (Fig. 2, pEXO*+9/+11; Fig. 3b, pENDO*+9/+11). A mutation at +6 to +8 in Piendo1, which did not cause a reduction in promoter activity of Piexo1, did reduce (to ca. 50%) the activity of the promoter of Piendo1 (Fig. 2, pEXO*+6/+8, and Fig. 3b, pENDO*+6/+8).

Deletion analyses of the promoter of Piexo1. Deletions at the 5' region of the 993-bp Piexo1 promoter resulted in various reductions in promoter activity (Fig. 4). The TSS in the Piexo1 promoter is designated as +1, resulting in the untranslated region ending at +69 and the 5' upstream promoter region being designated as –924. The shortest fragment of the 5' deletion plasmids that still had promoter activity was a 75-bp promoter fragment containing bp –6 to +69 [Fig. 4, pEXO(–6 to +69)].



View larger version (31K):
[in this window]
[in a new window]
 
FIG. 4. Deletion analyses of the Piexo1 promoter of P. infestans. The histogram shows GUS activities of P. infestans protoplasts transformed with Piexo1-GUS constructs with deletions in the 5' and 3' promoter regions of Piexo1. The activity of each deletion construct is shown as a percentage of the activity of the wild-type promoter (pEXO) and is the mean ± standard deviation of four independent experiments. The conserved 16-nt core sequence in the promoter of Piexo1 is indicated by a black square. The transcriptional start site (+1) is indicated by a right-angled arrow, and deletions are indicated by dashed lines.

 
Deletions at the 3' promoter region of Piexo1 suggest that this region could be important for promoter function (Fig. 4). Only a low level of promoter activity was detected when bases +11 to +69 were deleted [Fig. 4, pEXO(–924 to +12)]. Interestingly, a construct that contained 10 bp more (+21 to +69 deleted) showed an increase in promoter activity [Fig. 4, pEXO(–924 to + 22)]. These results suggest that bases +12 to +22 could be important for promoter function, although 3' deletions can also affect mRNA's stability and translation. Collectively, the 5' and 3' deletion analyses showed that only fragments containing the 19-nt core sequence were able to maintain some promoter activity and that the minimal promoter of Piexo1 could possibly consist of the region –6 to +12.

Gain-of-function constructs. A 75-bp region (–6 to +69) of Piexo1 [pEXO(–6 to + 69)] containing the core promoter region was able to respond to a 493-bp upstream promoter fragment of Piexo1 (Fig. 4). The addition of the 493 upstream base pairs to the pEXO(–6 to +69) construct increased the promoter activity of pEXO(–6 to +69) from 36 to 76% [Fig. 4, pEXO(–924||+69) and pEXO(–6 to +69)].

P. infestans EMSAs. EMSAs were used to determine if promoter fragments of Piexo1 (31 bp) and Piendo1 (36 bp), each containing the 19-nt core sequence, had specific interactions with proteins in a P. infestans whole-cell protein extract (Fig. 5). In EMSA studies of both promoter regions, excess molar amounts (200 and 400x for Piexo1 and 50 and 100x for Piendo1) of nonlabeled wild-type oligonucleotides were able to compete with binding of the corresponding 32P-labeled wild-type oligonucleotides (Fig. 5a and b, lanes 1 to 3). This showed that the protein complex in the EMSA was due to specific binding of each of the core promoter regions to a protein or protein complex in the extract.

Mutated double-stranded oligonucleotides containing the core promoter of Piexo1 and Piendo1 were further used in the EMSA to determine if there was a correlation between protein binding and core promoter function, as determined in the transient assays. The same mutations (pEXO*+1/+3, pEXO*+9/+11, pENDO*+9/+11, and pENDO*+6/+8) that reduced GUS levels in transient expression assays (Fig. 2 and 3b) also reduced binding of the EMSA complex (Fig. 5). Mutations (pEXO*+6/+8 and pENDO*+2) that did not reduce GUS levels in the transient expression assays (Fig. 2 and 3b) also did not drastically reduce binding of the EMSA complex (Fig. 5). This strongly suggests that the complexes observed for Piexo1 and Piendo1 in the EMSA contain a sequence-specific DNA-binding protein or proteins that contact the core promoter regions of Piexo1 and Piendo1.

The band intensities produced in the EMSAs were measured using a PhosphorImager and the Molecular Dynamics Image quant version 5.0 software. A correlation coefficient of –0.97 was obtained when the band intensities of the 400x competition lanes of the pEXO WT, pEXO*+1/+3, pEXO*+9/+11, and pEXO*+6/+8 oligonucleotides (Fig. 5a, lanes 3, 5, 7, and 9) were regressed against the relative percent GUS activities of the corresponding promoter constructs (Fig. 2). A correlation coefficient of –0.87 was obtained when the band intensities of the 100x competition lanes of the pENDO WT, pENDO*+9/+11, pENDO*+6/+8, and pENDO*+2 oligonucleotides (Fig. 5b, lanes 3, 5, 7, and 9) were regressed against the relative percent GUS activities of each corresponding promoter construct (Fig. 3b). The high correlation between the two different methods used to assay the effect of mutations within the 19-nt core promoter region confirms the importance of specific nucleotides within the core region.


    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We found that the core promoter regions of most oomycete genes sequenced by the summer of 2003 are comprised of a highly conserved 19-nt core region encompassing nucleotides –4 to +15 (Fig. 1). It includes the TSS in the vast majority of sequenced oomycete genes. Previously this core sequence had been identified as a 16-nt sequence (–4 to +12) (40). Sequence comparison, transient expression assays, and protein binding studies support the presence of two regions within the 19-nt region that are particularly important for core promoter function (Fig. 1, 2, 3, and 5). The first region (–2 to +5), encompassing the TSS, contains a known eukaryotic core promoter element, i.e., the initiator (Inr). The second region (+7 to +15) downstream and flanking the Inr, hereafter referred to as flanking promoter region (FPR), previously has not been identified as a region important for core promoter function in any other eukaryote.

The putative Inr of oomycetes shows striking similarities with the Inr of Trichomonas, Drosophila, and mammals in several aspects. First, as in mammals, Trichomonas, and Drosophila, the oomycete Inr function is highly dependent on the A at +1, on a T or A at +3, and on a pyrimidine at –1. Mutation of these residues results in the most severe reduction in promoter function (17, 28, 29; Fig. 3). Second, eukaryotic Inr elements overlap the TSSs of genes and direct accurate transcription initiation (47). In oomycetes the Inr also overlaps the TSSs of the genes, although we do not know if it directs accurate transcription initiation (Fig. 1). Thirdly, the oomycete Inr consensus sequence (Y-C-A+1-T-T-Y-Y, where Y = pyrimidine) is similar to that of mammals (Y-Y[C]-A+1-N-T/A-Y-Y), Drosophila (T-C-A+1-G/T-T-T/C), and Trichomonas (T-C-A+1-T/C-T/A) (17, 28; Fig. 1).

Although only a limited number of oomycete promoter regions are known, our current data suggest that a substantial number of oomycete genes could possibly contain a core promoter structure consisting of the Inr and FPR. However, as more sequence data become available more diversity might be detected in oomycete core promoters. Nonetheless, it is intriguing that P. infestans and Trichomonas (protist) are the only two known eukaryotes that contain a core promoter structure where the Inr is overrepresented in genes, and there is an apparent absence of TATA boxes (28, 42). Other eukaryotes such as plants, metazoans, and Drosophila have more diverse core promoter structures, with the Inr being less common. For example, in metazoans and plants only a relatively small subset of the known genes contains an Inr, with the majority of known genes containing TATA boxes (34, 45). In these eukaryotes, Inr-containing genes are present mostly as genes that are regulated and not as housekeeping genes (34, 46). In Drosophila, analyses of 250 promoters showed that approximately 26% of genes contain an Inr and 43% contain a TATA box (23).

In eukaryotes, transcription from Inr-containing, TATA-less promoters is not well characterized and several different models have been hypothesized that might apply to Inr recognition when a TATA box is not present (10, 45, 51). One of these models, proposed by Kutach and Kadonaga for Drosophila (23), could possibly fit the data that we have obtained from analyzing the P. infestans Inr-containing region. The Drosophila model proposes direct recognition by a general transcription factor (TFIID-associated factor) of the Inr and an adjacent downstream element called DPE (downstream promoter element) (3, 4, 23). In this model the DPE (positioned at +28 to +32) functions cooperatively with the Inr, since a mutation in either the Inr or DPE abolishes promoter activity and binding of the general transcription factor TFIID (5). Similarly, in P. infestans we have found a putative sequence-specific element called FPR downstream from the Inr. Furthermore, as for Drosophila, mutations in either the P. infestans Inr or downstream element (FPR) result in a reduction of promoter function as well as a reduction in the binding of a protein complex detected in EMSA studies (Fig. 2, 3, and 5). This could suggest that, as in Drosophila, the oomycete Inr functions cooperatively with a downstream sequence-specific core promoter region, i.e., the FPR.

Our current knowledge of oomycete basal transcription is very limited. Future studies need to address important aspects of Inr function known to exist in other eukaryotes. For example, it is known that there are sequence-specific activator elements overlapping and adjacent to the Inr in some metazoan genes (10, 13). Furthermore, as more oomycete sequence data become available it will be important to carry out sequence and functional analyses of promoter regions to determine if other core promoter structures are represented in oomycetes. The identification of novel oomycete core promoter elements and transcription factors could provide targets for drugs to mitigate the harmful effects of this group of destructive pathogens.


    ACKNOWLEDGMENTS
 
We thank H. S. Judelson for providing plasmids for the P. infestans transformations. We also thank J. T. Lis for reading the manuscript and general comments. We further thank C. H. Haney for assistance with EMSA studies.


    FOOTNOTES
 
* Corresponding author. Mailing address: Cornell University, Department of Plant Pathology, Ithaca, NY 14853. Phone: (607) 255-4677. Fax: (607) 255 803. E-mail: wef1{at}cornell.edu. Back

{dagger} Present address: Botany Department, University of Pretoria, Pretoria 0002, South Africa. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Alexopoulos, C. J., C. W. Mims, and M. Blackwell. 1996. Introductory mycology, 4th ed. John Wiley & Sons, Inc., New York, N.Y.
  2. Brunt, S. A., M. Borkar, and J. C. Silver. 1998. Regulation of hsp90 and hsp70 genes during antheridiol-induced hyphal branching in the oomycete Achlya ambisexualis. Fungal Genet. Biol. 24:310-324.[Medline]
  3. Burke, T. W., and J. T. Kadonaga. 1997. The downstream core promoter element, DPE, is conserved from Drosophila to humans and is recognized by TAFII60 of Drosophila. Genes Dev. 11:3020-3031.[Abstract/Free Full Text]
  4. Burke, T. W., and J. T. Kadonaga. 1996. Drosophila TFIID binds a conserved downstream basal promoter element that is present in many TATA-box-deficient promoters. Genes Dev. 10:711-724.[Abstract/Free Full Text]
  5. Burke, T. W., P. J. Willy, A. K. Kutach, J. E. F. Butler, and J. T. Kadonaga. 1998. The DPE, a conserved downstream core promoter element that is functionally analogous to the TATA. Cold Spring Harbor Symp. Quant. Biol. 63:75-82.[CrossRef][Medline]
  6. Butler, J. E. F., and J. T. Kadonaga. 2002. The RNA polymerase II core promoter: a key component in the regulation of gene expression. Genes Dev. 16:2583-2592.[Free Full Text]
  7. Carey, M., and S. T. Smale. 2000. Transcriptional regulation in eukaryotes. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  8. Cavalier-Smith, T. 2000. Membrane heredity and early chloroplast evolution. Trends Plant Sci. 5:174-182.[CrossRef][Medline]
  9. Chen, Y., and R. Roxby. 1997. Identification of a functional CT-element in the Phytophthora infestans piypt1 gene promoter. Gene 198:159-164.[CrossRef][Medline]
  10. Cheriyath, V., C. D. Novina, and A. L. Roy. 1998. TFII-I regulates Vß promoter activity through an initiator element. Mol. Cell. Biol. 18:4444-4454.[Abstract/Free Full Text]
  11. Dudler, R. 1990. The single-copy actin gene of Phytophthora megasperma encodes a protein considerably diverged from any other known actin. Plant Mol. Biol. 14:415-422.[Medline]
  12. Gallagher, S. (ed.). 1992. GUS protocols: using the GUS gene as a reporter of gene expression. Academic Press, Inc., San Diego, Calif.
  13. Garraway, I. P., K. Semple, and S. T. Smale. 1996. Transcription of the lymphocyte-specific terminal deoxynucleotide transferase gene requires a specific core promoter structure. Proc. Natl. Acad. Sci. USA 93:4336-4341.[Abstract/Free Full Text]
  14. Goodwin, S. B., L. J. Spielman, J. M. Matuszak, S. N. Gergeron, and W. E. Fry. 1992. Clonal diversity and genetic differentiation of Phytophthora infestans populations in northern and central Mexico. Phytopathology 82:955-961.
  15. Gotesson, A., J. S. Marshall, D. A. Jones, and A. R. Hardman. 2002. Characterization and evolutionary analysis of a large polygalacturonase gene family in the oomycete plant Phytophthora cinnamomi. Mol. Plant-Microbe Interact. 15:907-921.[Medline]
  16. Green, P. J., S. A. Kay, E. Lam, and N. Chua. 1989. In vitro DNA footprinting, p. B11:1-22. In S. B. Gelvin, R. A. Schilperoort, and D. P. S. Verma (ed.), Plant molecular biology manual. Kluwer Academic Publishers, Dordrecht, The Netherlands.
  17. Javahery, R., A. Khachi, K. Lo, B. Zenzie-Gregory, and S. T. Smale. 1994. DNA sequence requirements for transcriptional initiator activity in mammalian cells. Mol. Cell. Biol. 14:116-127.[Abstract/Free Full Text]
  18. Judelson, H. S. 1996. Recent advances in the genetics of oomycete plant pathogens. Mol. Plant-Microbe Interact. 9:443-449.
  19. Judelson, H. S., and R. W. Michelmore. 1990. Highly abundant and stage specific mRNAs in the obligate pathogen Bremia lactucae. Mol. Plant-Microbe Interact. 3:225-232.[Medline]
  20. Judelson, H. S., and R. W. Michelmore. 1991. Transient expression of genes in the oomycete Phytophthora infestans using Bremia lactucae regulatory sequences. Curr. Genet. 19:453-459.[CrossRef]
  21. Judelson, H. S., B. M. Tyler, and R. W. Michelmore. 1992. Regulatory sequences for expressing genes in oomycete fungi. Mol. Gen. Genet. 234:138-146.[Medline]
  22. Kamoun, S., K. M. Klucher, and M. D. Coffey. 1993. A gene encoding a host-specific elicitor protein of Phytophthora parasitica. Mol. Plant-Microbe Interact. 6:573-582.[Medline]
  23. Kutach, A. K., and J. T. Kadonaga. 2000. The downstream promoter element DPE appears to be as widely used as the TATA box in Drosophila core promoters. Mol. Cell. Biol. 20:4754-4764.[Abstract/Free Full Text]
  24. Lagrange, T., A. N. Kapanidis, H. Tang, D. Reinberg, and R. H. Ebright. 1998. New core promoter element in RNA polymerase II-dependent transcription: sequence-specific DNA binding by transcription factor IIB. Genes Dev. 12:34-44.[Abstract/Free Full Text]
  25. Laxalt, A. M., M. Latijnhouwers, M. van Hulten, and F. Govers. 2002. Differential expression of G protein {alpha} and ß subunit genes during development of Phytophthora infestans. Fungal Genet. Biol. 36:137-146.[CrossRef][Medline]
  26. Lee, T. I., and R. A. Young. 2000. Transcription of eukaryotic protein-coding genes. Annu. Rev. Genet. 34:77-137.[CrossRef][Medline]
  27. LeJohn, H. B., L. E. Cameron, B. Yang, G. MacBeath, D. S. Barker, and S. A. Williams. 1994. Cloning and analysis of a constitutive heat shock (cognate) protein 70 gene inducible by L-glutamine. J. Biol. Chem. 269:4513-4522.[Abstract/Free Full Text]
  28. Liston, D. R., and P. J. Johnson. 1999. Analysis of a ubiquitous promoter element in a primitive eukaryote: early evolution of the initiator element. Mol. Cell. Biol. 19:2380-2388.[Abstract/Free Full Text]
  29. Lo, K., and S. T. Smale. 1996. Generality of a functional initiator consensus sequence. Gene 182:13-22.[CrossRef][Medline]
  30. Mao, Y., and B. M. Tyler. 1996. Cloning and sequence analysis of elicitin genes of Phytophthora sojae. Fungal Genet. Biol. 20:169-172.[CrossRef][Medline]
  31. Marshall, J. S., A. R. Ashton, F. Govers, and A. R. Hardman. 2001. Isolation and characterization of four genes encoding pyruvate, phosphate dikinase in the oomycete plant pathogen Phytophthora cinnamomi. Curr. Genet. 40:73-81.[CrossRef][Medline]
  32. McLeod, A., C. D. Smart, and W. E. Fry. 2003. Characterization of 1,3-ß-glucanase and 1,3;1,4-ß-glucanase genes from Phytophthora infestans. Fungal Genet. Biol. 38:250-263.[Medline]
  33. Mort-Bontemps, M., L. Gay, and M. Fevre. 1997. CHS2, a chitin synthase gene from the oomycete Saprolegnia monoica. Microbiology 6:2009-2020.
  34. Nakamura, M., T. Tsunoda, and J. Obokata. 2002. Photosynthesis nuclear genes generally lack TATA-boxes: a tobacco photosystem I gene responds to light through an initiator. Plant J. 29:1-10.[CrossRef][Medline]
  35. Novina, C. D., and A. L. Roy. 1996. Core promoters and transcriptional control. Trends Genet. 12:351-355.[CrossRef][Medline]
  36. Panabieres, F., A. Marais, J. L. Berre, D. Fournier, and P. Ricci. 1995. Characterization of a gene cluster of Phytophthora cryptogea which codes for elicitins, proteins inducing a hypersensitive-like response in tobacco. Mol. Plant-Microbe Interact. 8:996-1003.[Medline]
  37. Perry, K. L., and R. I. B. Francki. 1992. Insect-mediated transmission of mixed and re-assorted cucumovirus genomic RNAs. J. Gen. Virol. 73:2105-2114.[Abstract/Free Full Text]
  38. Pieterse, C. M. J., E. P. Risseeuw, and L. C. Davidse. 1991. An in planta induced gene of Phytophthora infestans codes for ubiquitin. Plant Mol. Biol. 17:799-811.[Medline]
  39. Pieterse, C. M. J., H. M. Verbakel, J. Spaans, L. C. Davidse, and F. Govers. 1993. Increased expression of the calmodulin gene of the late blight fungus Phytophthora infestans during pathogenesis on potato. Mol. Plant-Microbe Interact. 6:164-172.[Medline]
  40. Pieterse, C. M. P., P. van West, M. Verbakel, P. W. H. M. Brasse, G. C. M. van den Berg-Velthuis, and F. Govers. 1994. Structure and genomic organization of the ipiB and ipiO gene clusters of Phytophthora infestans. Gene 138:67-77.[CrossRef][Medline]
  41. Purnell, B. A., P. A. Emanuel, and D. S. Gilmour. 1994. TFIID sequence recognition of the initiator and sequence farther downstream in Drosophila class II genes. Genes Dev. 8:830-842.[Abstract/Free Full Text]
  42. Quon, D. V. K., M. G. Delgadillo, A. Khachi, and S. T. Smale. 1994. Similarity between a ubiquitous promoter element in an ancient eukaryote and mammalian initiator elements. Proc. Natl. Acad. Sci. USA 91:4579-4583.[Abstract/Free Full Text]
  43. Roeder, R. G. 1996. The role of general initiation factors in transcription by RNA polymerase II. Trends Biochem. Sci. 21:327-335.[CrossRef][Medline]
  44. Sacks, W., T. Nurnberger, K. Hahlbrock, and D. Scheel. 1995. Molecular characterization of nucleotide sequences encoding the extracellular glycoprotein elicitor from Phytophthora megasperma. Mol. Gen. Genet. 246:45-55.[CrossRef][Medline]
  45. Smale, S. T. 1997. Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes. Biochim. Biophys. Acta Gene Struct. Expr. 1351:73-88.[Medline]
  46. Smale, S. T., and D. Baltimore. 1989. The "Initiator" as a transcription control element. Cell 57:103-113.[CrossRef][Medline]
  47. Smale, S. T., A. Jain, J. Kaufmann, K. H. Emami, K. Lo, and I. P. Garraway. 1998. The Initiator element: a paradigm for core promoter heterogeneity within metazoan protein-coding genes. Cold Spring Harbor Symp. Quant. Biol. 63:21-31.[CrossRef][Medline]
  48. Unkles, S. E., R. P. Moon, A. R. Hawkins, J. M. Duncan, and J. R. Kinghorn. 1991. Actin in the oomyceteous fungus Phytophthora infestans is the product of several genes. Gene 100:105-112.[CrossRef][Medline]
  49. Van der Peer, Y., S. L. Baldauf, W. F. Doolittle, and A. Meyer. 2000. An updated and comprehensive rRNA phylogeny of (crown) eukaryotes based on rate-calibrated evolutionary distance. J. Mol. Evol. 51:565-576.[Medline]
  50. Verrijzer, C. P., and R. Tjian. 1996. TAFs mediate transcriptional activation and promoter selectivity. Trends Biochem. Sci. 21:338-342.[CrossRef][Medline]
  51. Weis, L., and D. Reinberg. 1997. Accurate positioning of RNA polymerase II on a natural TATA-less promoter is independent of TATA-binding-protein-associated factors and initiator-binding proteins. Mol. Cell. Biol. 17:2973-2984.[Abstract]
  52. Woychik, N. A., and M. Hampsey. 2002. The RNA polymerase II machinery: structure illuminates function. Cell 108:453-463.[CrossRef][Medline]


Eukaryotic Cell, February 2004, p. 91-99, Vol. 3, No. 1
1535-9778/04/$08.00+0     DOI: 10.1128/EC.3.1.91-99.2004
Copyright © 2004, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McLeod, A.
Right arrow Articles by Fry, W. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McLeod, A.
Right arrow Articles by Fry, W. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Appl. Environ. Microbiol. Infect. Immun. J. Bacteriol.
Mol. Cell Biol. Microbiol. Mol. Biol. Rev. ALL ASM JOURNALS