| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Molecular Genetics and Microbiology,1 Medicine,3 Pharmacology and Cancer Biology,4 Howard Hughes Medical Institute, Duke University Medical Center, Durham, North Carolina 277102
Received 27 June 2003/ Accepted 26 July 2003
| ABSTRACT |
|---|
|
|
|---|
mating types but are predominantly sterile, the majority of the Vancouver outbreak strains are exclusively of the
mating type and the majority are fertile. In an effort to enhance mating of these isolates, we identified and disrupted the CRG1 gene encoding the GTPase-activating protein involved in attenuating pheromone response. crg1 mutations dramatically increased mating efficiency and enabled mating with otherwise sterile isolates. Our studies provide a genetic and molecular foundation for further studies of this primary pathogen and reveal that the Vancouver Island outbreak may be attributable to a recent recombination event. | INTRODUCTION |
|---|
|
|
|---|
mating type has been linked to virulence (25) and sexual recombination produces spores, the suspected infectious propagule (43; J. Cohen, J. R. Perfect, and D. T. Durack, Letter, Lancet i:1301, 1982). C. neoformans is a haploid, encapsulated yeast that is the most common cause of fungal meningitis, which is fatal if untreated (17, 22, 29). C. neoformans strains can be classified into three divergent varieties and four serotypes based on capsular antigens: C. neoformans var. neoformans (serotype D), C. neoformans var. grubii (serotype A), and C. neoformans var. gattii (serotypes B and C). Serotypes A (the most clinically prevalent) and D are opportunistic pathogens that infect immunocompromised individuals throughout the world, whereas the divergent B and C serotypes are primary pathogens that infect predominantly immunocompetent hosts (40). In contrast to serotypes A and D, which are cosmopolitan and most frequently associated with pigeon guano, the serotype B and C C. neoformans var. gattii is usually restricted to tropical and subtropical regions of the world, where it is found in association with woody debris of eucalyptus trees (10).
Mating among serotype D strains (the least virulent variety) has been well characterized, and a congenic pair has been created to facilitate genetic analysis (16, 25). In contrast, the first accounts of the characterization of mating among serotype A C. neoformans var. grubii strains have only recently been reported (18, 35), an advance that was made possible by the discovery of a isolates long thought to be extinct (30, 45). The sexual system is bipolar (involving a and
cell types) and is dependent on an unusually large mating type locus (28).
Serotype A (C. neoformans var. grubii) strains exist predominantly as clonal isolates of the
mating type throughout the world (12, 23, 47). In contrast, mixed populations of a and
C. neoformans var. gattii strains have been identified colonizing hollows of eucalyptus trees in the Australian environment, where there is a relatively high incidence of cryptococcosis in native animals and indigenous human populations (4, 11, 14, 15). Despite the presence of both mating types, no meiotic recombination has been detected, suggesting that this ecological niche may support only clonal propagation of yeast cells and that sexual development occurs elsewhere if at all (15).
Interest in the primary pathogenic form of C. neoformans has increased due to an outbreak of C. neoformans var. gattii infection on Vancouver Island in Canada. Prior to 1999, an average of two or three cases of cryptococcosis occurred annually in British Columbia and were caused by infections with serotype D. Since 1999, more than 66 human cases in otherwise healthy individuals, with at least four fatalities, have been reported and are attributable to infection with serotype B (M. Fyfe, W. Black, M. Romney, P. Kibsey, L. MacDougall, M. Starr, M. Pearce, C. Stephen, L. Stein, S. Mak, B. Emerson, J. Isaac-Renton, and D. Patrick, 5th Int. Conf. Cryptococcus Cryptococcosis, abstr. P1.1, 2002). There has also been an equally large increase in the rate of infection of animals, including dogs, cats, and porpoises (41). On Vancouver Island, C. neoformans var. gattii has been found in association with a number of native tree species (Douglas fir, alder, maple, and Garry oak) rather than eucalyptus trees, a previously identified environmental source of this variety. This expansion of the serotype B habitat to include nontropical areas increases the human risk of acquiring cryptococcosis and makes it paramount to understand the mechanisms by which C. neoformans var. gattii reproduces sexually.
Our studies address the role of sexual reproduction in the life cycle and virulence of C. neoformans. The majority of C. neoformans var. gattii strains are sterile under most laboratory conditions. Although the perfect state of C. neoformans var. gattii was first reported over 25 years ago (21), these findings have proven difficult to reproduce (14, 26, 31, 34). Here we have recapitulated and extensively analyzed the sexual cycle of C. neoformans var. gattii. First, we describe conditions that support mating of a number of serotype B and C isolates from diverse sources. Second, we show that the vast majority of isolates from the Vancouver Island outbreak are fertile and that all are of the
mating type. Third, we identify a pair of a and
strains that mate robustly to produce viable meiotic progeny, providing a platform for genetic studies. Finally, we perform targeted gene disruptions in this variety and define a conserved role for the regulator of G protein signaling (RGS) protein Crg1 in pheromone sensing by demonstrating that crg1
strains mate more vigorously than wild-type strains. Taken together, our studies provide a genetic and molecular foundation for further studies of this primary pathogen and reveal that the Vancouver Island outbreak may be attributable to a recent recombination event in an unusual, fertile clade of C. neoformans.
| MATERIALS AND METHODS |
|---|
|
|
|---|
) (16, 25). Strains were grown on yeast extract-peptone-dextrose (YEPD) medium. Mating assays were carried out on V8 medium (24) (5% [vol/vol] V8 juice, 3 mM KH2PO4, 4% [wt/vol] agar) at pH 5 or 7, carrot medium (5% [vol/vol] carrot juice, 3 mM KH2PO4, 4% agar), or synthetic low ammonium dextrose (SLAD) medium. The ability to mate was tested against the serotype D tester strains JEC20 and JEC21, the serotype C strains NIH312 (
) and B4546 (a), and crg1
mutant derivatives JF101 (
) and JF109 (a). Strains were pregrown on YEPD agar for 2 days, and a small amount of cells was removed and patched onto solid mating medium either alone or mixed with a reference strain. Plates were incubated at room temperature in the dark for 9 days and assessed by light microscopy for filament and basidiospore formation. Molecular techniques. Standard methods were performed as described by Sambrook et al. (37). Serotyping was done using the Crypto Check serotyping kit from Iatron Laboratories (Tokyo). C. neoformans genomic DNA for Southern blot analysis was prepared as described by Pitkin et al. (36). C. neoformans biolistic transformation was performed using the technique for serotype D as described by Davidson et al. (7).
Primers.
Sequences of primers are as follows: STE12
U, CAATCTCAAAGCGGGGACAG; STE12
L, CTTTGTTTCGGTCCTAATACAGCC; JOHE6013,GCAACCAATCACTATGAA; JOHE6014, TGTGATCTGGTTCATGTA; JOHE8733, GCTGCGAGGATGTGAGCTGGA; JOHE8734, TCCATCTTGTTCAATCATAGACATGTTGGGCGAGTT; JOHE8735, AACTCGCCCAACATGTCTATGATTGAACAAGATGGA; JOHE8736, ACCCCTTACCGCCTTCACTCAGAAGAACTCGTCAAG; JOHE8737, CTTGACGAGTTCTTCTGAGTGAAGGCGGTAAGGGGT; JOHE8738, GGTTTATCTGTATTAACACGG; JOHE8896, CCCCTTCAACACAGCTCTTTA; JOHE8897, CAAGCCACCGGTCCTTATCCC; JOHE8987, AAGTTCGGACTGATTTATTCA; JOHE8988, CGGAGGATAGAAGCTGTAAGCCAAAGTAAGGGGTAAGTTGGCAGA; JOHE8989, CCGTGTTAATACAGATAAACCGTCTTCAGAATACGAAAAGGACGA; JOHE8990, AAGCAAGACGGGACTTATTGT; JOHE9365, CAGAAACGGTAACGGGAGCAC; JOHE9366, GCCCCTTCTTTCCTTATTCCT; JOHE9421, ATCCGCCCTCGAGTCAAA; JOHE9422, TGGCGACCGACTGTAGAT; JOHE9779, CCTTACTCCATAACCCGCTAC; JOHE9780, AATTTCATAACGCTTTGGGAA; JOHE9787, ACACCGCCTGTTACAATGGAC; JOHE9788, CAGCGTTTGAAGATGGACTTT; JOHE9574, ATTCGCCACCGGTTTATCTGTATTAAC; JOHE9575, ATTCGCCCTTTAAACGAGGATGTGAGC; JOHE9592, GAGTTCAGGCTTTTTCATAGACATGTTGGGCGAGTT; JOHE9593, AACTCGCCCAACATGTCTATGAAAAAGCCTGAACTC; JOHE9594, ACCCCTTACCGCCTTCACCTATTCCTTTGCCCTCGG; JOHE9595, CCGAGGGCAAAGGAATAGGTGAAGGCGGTAAGGGGT.
Determination of mating type.
Mating type was established by PCR using genomic DNA prepared with the Camgen yeast genomic DNA extraction kit (Whatman BioSciences Ltd., Cambridge, United Kingdom) with primers specific to the STE20a (JOHE9421-JOHE9422), STE12
(STE12
U-STE12
L), MFa (JOHE9787-JOHE9788), and MF
(JOHE9779-JOHE9780) genes. PCR was repeated twice.
Plasmids. The Neor marker cassette clone pJAF1 was generated by combining the serotype A strain H99 ACT1 promoter (JOHE8733-JOHE8734), the transposon Tn5 Neor gene (JOHE8735-JOHE8736), and the H99 TRP1 terminator (JOHE8737-JOHE8738) via overlap PCR using primer pair JOHE8733-JOHE8738 and cloned into plasmid pCR-TOPO2.1. The Hygr marker cassette clone pJAF15 was created in an equivalent fashion by combining the ACT1 promoter (JOHE8733-JOHE9592), the Hygr gene (JOHE9593-JOHE9594), and the TRP1 terminator (JOHE9595-JOHE8738) via overlap PCR using primer pair JOHE8733-JOHE8738 and cloned into plasmid pCR-TOPO2.1. Bacterial artificial chromosomes (BACs) containing the serotype B CRG1 gene (Australian isolates WM276 BAC 2B19 and E566 BAC 2B13) were identified by hybridization with a 1.2-kb CRG1 PCR fragment (JOHE6013-JOHE6014) from the serotype A strain H99. Based on results of Southern blot analysis, the CRG1 gene was subcloned as a 6.5-kb XhoI fragment into pBluescript SK- SalI to yield plasmids pJAF2 (WM276) and pJAF3 (E566). Sequencing of the 6.5-kb subclones revealed only one single nucleotide polymorphism between the two isolates. The CRG1 reconstitution plasmid was created by amplifying the pCH233 Natr cassette (JOHE9574-JOHE9575), digesting it with AgeI/DraI, and using it to replace the NgoMIV/BsaA1 f1 origin fragment of pBluescript SK- to give the Natr cloning plasmid pJAF13. The WM276 CRG1 gene was then subcloned from pJAF2 into pJAF13 as a 6.6-kb ApaI/PstI fragment, yielding pJAF14.
Disruption of the CRG1 gene. crg1 deletion alleles for the Australian isolates were generated by replacing the 3-kb Eco47III/SpeI fragment of the CRG1 gene in plasmid pJAF2 with the Natr cassette from plasmid pCH233 and the Neor cassette from plasmid pJAF1 as an EcoRV/XbaI fragment to yield plasmids pJAF4 and pJAF6, respectively.
With the use of the CRG1 gene sequence from strain WM276, overlap primers were designed to allow the construction of deletion alleles in strains NIH312, B4546, and R265 without the need to subclone and sequence the CRG1 gene. Building upon the technique of deletion allele generation by overlap PCR (6), we found that the process could be simplified by avoiding the use of chimeric primers for the marker segment, reducing the number of gene-specific primers required from six to four (Fig. 1). Furthermore, the design of the Neor and Hygr cassettes allows the same primer sets to be used for either a Neor, Natr, or Hygr disruption cassette. PCR was used to generate CRG1 5' (JOHE8987-JOHE9094), 3' (JOHE8989-JOHE8990), and Neor (JOHE8733-JOHE8738) products, which were combined in a PCR overlap reaction (JOHE8987-JOHE8990) to yield strain-specific CRG1 deletion alleles. We used biolistic transformation for each strain of interest, introducing the appropriate circular plasmid (in strains WM276 and E566) or overlap PCR product (in strains B4546, NIH312, and R265) and selecting for resistance to G418 (200 µg/ml) or nourseothricin (100 µg/ml). crg1
transformants were identified by Southern blotting using the 6.5-kb WM276 CRG1 gene fragment as a probe (data not shown). Homologous integration frequencies were higher with overlap PCR products (7 of 60 for B4546, 6 of 70 for NIH312, and 15 of 32 for R265) than with circular plasmid-borne crg1 deletion alleles (2 of 86 and 2 of 65 for the E566 Natr and Neor alleles, respectively, and 2 of 17 for the WM276 Neor allele).
|
Slide matings. Glass microscope slides were sterilized, placed at a 20° angle in a plastic petri dish by using a sterile microfuge tube, and coated with a thin layer of molten V8 agar, with 5 ml of liquid V8 medium added to the bottom of each. The strains to be mated were resuspended in distilled H2O, and 10 µl was pipetted at the apex of the slide and allowed to drain down the slide, creating a mating patch 3 to 4 cm in length and 0.5 cm wide. Slides were incubated at room temperature for 3 to 5 days in the dark.
Microscopy and staining. For filament staining, slides were transferred to a fresh petri dish, washed three times with 10 ml of phosphate-buffered saline (PBS), fixed in 10 ml of 70% ethanol for 20 min, washed three times with PBS, permeabilized with 1% Triton X-100 in PBS for 10 min, and washed three times with PBS prior to staining. To visualize septa and DNA, filaments from matings were incubated in a 10-ml preparation of calcofluor white (fluorescent brightener 28 F-3397; Sigma) at 20 µg/ml and a 5,000x dilution of a 5 mM solution of Sytox Green (Molecular Probes) in PBS for 20 min. Agar sections containing filaments were mounted on fresh microscope slides with 5 µl of antifade (1 mg of p-phenylenediamine/ml in 50% glycerol).
Bright field, differential interference microscopy (DIC), and fluorescent images were captured with a Zeiss Axioskop 2 Plus fluorescent microscope equipped with an AxioCam MRM digital camera and corresponding software.
Environmental scanning electron microscopy (ESEM) was performed using a Philips XL30 ESEM TMP (FEI Company, Portland, Oreg.). Mating reactions were carried out on V8 plates, fixed by exposure to osmium tetroxide vapor for 30 min, and excised blocks of agar were adhered to prechilled stubs by using double-sided tape. The samples were viewed with a secondary electron detector at pressures of 5.2 to 5.5 torr and temperatures of 2.5 to 4.4°C and with a beam of 15 to 18 kV. Working distance ranged from 8.7 to 11 mm.
Nucleotide sequence accession numbers. The sequence for the CRG1 genes of strains WM276 and E566 has been deposited in GenBank under accession number AY327612. The accession numbers for the partial sequences of the SOD1 and PLB1 genes are AY327613 and AY327615 for NIH312 and AY327614 and AY327616 for B4546, respectively.
| RESULTS |
|---|
|
|
|---|
(JEC21) strains on V8 pH 7 medium (see Table S1 in the supplemental material). Our collection consisted of three groups: laboratory serotype B (20) and C (14) isolates from diverse sources, Vancouver Island outbreak serotype B isolates (83), and Australian serotype B isolates (28).
Analysis of the lab isolates revealed that 18 of 34 (53%) were sterile when mated with the appropriate serotype D tester strain. Of the 47% that did mate, mating was exclusively with partners of a single mating type (a or
). Accordingly, PCR analysis of these isolates with primers for
-specific and a-specific genes revealed that each isolate was of a single mating type (see Table S1 in the supplemental material).
The Australian isolates exhibited a different pattern. Of the clinical isolates, three of six (50%) mated with the tester strains. In contrast, 100% (22 of 22) of the environmental isolates were sterile. Overall, only 10% of isolates obtained from Australia were fertile.
Importantly, the majority of the Vancouver Island outbreak isolates were fertile (70%, or 58 of 83). In contrast to isolates from Australia and elsewhere, which were both a and
, all of the Vancouver isolates were of the
mating type. Additionally, the mating abilities of the Vancouver Island outbreak isolates were not correlated with their clinical or environmental origins.
A C. neoformans var. gattii pair can mate robustly.
Most previous attempts to recapitulate mating of C. neoformans var. gattii used the type cultures NIH444 (serotype B and mating type
) and NIH191 (serotype C and mating type a). We found that both of these isolates mated with the appropriate serotype D tester strains, but mating to each other was much more difficult to detect and produced only a very weak mating reaction that was restricted to V8 pH 5 or carrot medium and required incubation for 6 weeks (data not shown).
Further analysis of our collection revealed an alternative pair of serotype C isolates (NIH312,
, and B4546, a) (Fig. 2) that mated with serotype D tester strains and robustly with each other. These isolates also mated with the type strains NIH444 and NIH191. We retested our collection of 146 isolates with this new mating pair. All of the strains that were mating competent with the serotype D testers also mated with these serotype C tester strains (see Table S1 in the supplemental material; Fig. 2). Additionally, we detected mating with 18 additional isolates from Vancouver Island (nine clinical or veterinary and nine environmental) that failed to mate with the serotype D strains, raising the percentage of mating-competent outbreak isolates from 70 to 91%.
|
strains B4546 and NIH312 exhibit morphological features characteristic of those produced by mating of basidiomycetes, including segregation of two haploid nuclei per filament cell and the production of fused clamp connections that enable faithful segregation of these nuclei. In contrast to serotype D crosses, which produce long peripheral hyphae, the intervarietal and serotype C intravarietal crosses produce abundant, shorter filaments primarily above the mating reaction. Calcofluor white staining revealed the presence of fused clamp connections (Fig. 3). Also unlike mating serotype D strains, mating serotype C strains form a protrusion from the subapical cell to which the clamp fuses, reminiscent of the peg structures observed in Coprinus cinereus (Fig. 3A) (20). This structure was not observed in serotype D in intervarietal crosses with serotype C (data not shown). Sytox Green staining revealed that each filament cell was dikaryotic and contained paired, comigrating nuclei (Fig. 3).
|
|
Dominant selectable markers in C. neoformans var. gattii. To facilitate molecular studies of spore formation in C. neoformans var. gattii, we investigated the efficacy of several dominant markers in serotypes B and C. We confirmed that biolistic transformation of strains NIH312, B4546, R265, WM276, and E566 with the Natr cassette (33) plasmid pCH233 conferred resistance to nourseothricin (100 µg/ml). Firstly, this verified that we could use biolistic transformation to transform a variety of serotype B and C strains, and secondly it demonstrated that the serotype A strain H99 ACT1 promoter that drives the cassette can function in all four serotypes.
Building upon the design of the Natr cassette, we generated two derivatives by overlap PCR, replacing the Natr coding region with the Tn5 Neor gene (pJAF1) or the Escherichia coli Hygr gene (pJAF15). Biolistic transformation of serotype A strain H99, serotype B strains R265, WM276, and E566, serotype C strains NIH312 and B4546, and the serotype D strain JEC21 with these plasmids confirmed that pJAF1 and pJAF15 were sufficient to confer resistance to G418 (200 µg/ml) and hygromycin B (200 µg/ml), respectively, in all four serotypes of C. neoformans. Previous marker cassettes designed to confer resistance to hygromycin B had not functioned in serotypes B and C (5).
Differentially marked serotype C strains mate to produce recombinant spores.
The morphology of C. neoformans var. gattii is distinct from those of C. neoformans var. neoformans and C. neoformans var. grubii, as C. neoformans var. gattii forms both round and elongated cells during infection (44) and elongated spores during mating (21). Elongated vegetative cells also form during growth on V8 medium irrespective of the mating partner and are difficult to distinguish from basidiospores during microdissection. Therefore, to select meiotic progeny, we differentially marked the serotype C mating pair NIH312 and B4546 by biolistic transformation with the Natr and Neor cassettes. These marked strains (MAT
Natr [JF65] and MATa G418r ura5 [JF66]) were mated for 6 days and plated onto YEPD medium containing nourseothricin and G418. Similar to results with serotype D, stable Natr G418r diploids were obtained at 37°C that were thermally dimorphic, growing as yeast at 37°C but self-filamentously on V8 medium at 25°C (38). By selecting at 30°C, we could identify Natr G418r recombinant isolates that were not thermally dimorphic. To validate that these were bona fide meiotic progeny, we analyzed the segregation of four markers in a subset of the nonfilamentous isolates and observed recombinant progeny (Fig. 5). The markers included ura5 (from the a parent), RFLPs in the PLB1 and SOD1 genes, and the MAT locus (a and
). This analysis demonstrates that a random spore analysis approach can be used to isolate mating-competent meiotic progeny of serotype C.
|
subunit to silence signaling (1, 8). The C. neoformans SST2 homologue is the CRG1 gene, and crg1 mutations enhance mating of serotype A (35; P. Wang, personal communication). Here we show that a CRG1-targeted gene disruption enhances mating of serotypes B and C.
The first targeted gene disruption in C. neoformans var. gattii, that of the serotype B SOD1 gene with the use of the URA5 gene, was recently reported (34). We disrupted the CRG1 gene in the serotype B strain WM276 by using dominant selectable markers that confer resistance to nourseothricin or G418. We also isolated crg1::Neor mutations in the serotype C mating pair NIH312 (
) and B4546 (a) and the Vancouver Island clinical isolate R265 (
).
When cocultured with a strain of the opposite mating type, the crg1 mutant derivatives of NIH312, B4546, and R265 underwent much more rapid and proliferative mating reactions than the wild types, producing more hyphae and basidia (Fig. 6). This was also observed in intervarietal matings with serotype D strains. The enhanced mating of the crg1 mutant strains was restored to the wild-type level when the wild-type CRG1 gene was reintroduced (data not shown). Comparison of unilateral mutant crosses to bilateral mutant crosses revealed that the effect of the crg1 mutation is additive. Deletion of CRG1 was sufficient to allow mating on YEPD, a medium that usually strongly represses mating, in the case of a unilateral or bilateral cross (data not shown), indicating that this mutation is sufficient to bypass the nutritional limitation and desiccation signals normally required for C. neoformans mating.
|
strains exhibited any detectable mutant phenotype, nor could the CRG1 wild-type Australian isolates WM276 (serotype B and mating type
) or E566 (serotype B and mating type a) mate with crg1
strains. Also, attempts to identify fusion of the B4546 crg1::Neor strain JF109 and the E566 crg1::Natr strain JF9 by selecting for diploids at 37°C on YEPD medium containing nourseothricin and G418 failed to identify Natr G418r strains. The failure of the Australian isolate E566 to produce mating structures is therefore due to a defect prior to fusion. This suggests that mutation of the CRG1 gene increases existing mating compatibility, leading to the production of more mating filaments. To test this hypothesis, we repeated our mating analysis of the original collection of 145 isolates by using NIH312 and B4546 crg1
mutants as tester strains. In all instances in which strains previously mated with NIH312 or B4546, this reaction was enhanced in a crg1
unilateral cross (see Table S1 in the supplemental material). In addition, one more serotype C strain (a total of 10 of 14, or 71%) and three more Vancouver Island environmental isolates (a total of 56 of 59, or 95%) mated. The crg1
strains are therefore useful tools for analyzing mating of C. neoformans var. gattii, allowing mating to be more readily observed and in some cases enabling otherwise sterile strains to mate. | DISCUSSION |
|---|
|
|
|---|
mating type, and in serotype D,
strains have been shown to be more pathogenic than a strains in a murine model (25). Second, the basidiospore is thought to be the infectious propagule. The sexual cycle and the components of the mating signaling cascade of C. neoformans var. neoformans have been studied intensely over the last decade, and recently this research has been extended to include serotype A C. neoformans var. grubii, in which a isolates and a complete sexual cycle have only recently been identified (18, 30, 35, 45). In contrast, the sexual cycle of C. neoformans var. gattii was first reported almost 30 years ago (21). Here we have recapitulated the original data on mating of C. neoformans var. gattii and extended these original studies by identifying strains that mate robustly with one another and with a large number of clinical and environmental isolates. Independently, Tscharke and Kwon-Chung have also identified serotype B strains capable of mating (R. L. Tscharke and K. J. Kwon-Chung, Abstr. 103rd Gen. Meet. Am. Soc. Microbiol., abstr. F-063, 2003). The recapitulation of data on mating and the discovery of robustly mating strains provide a platform for the generation of congenic serotype C strains and serve as an important foundation for genetic studies of this variety.
As we have previously observed for serotype A (35), some C. neoformans var. gattii isolates are sterile, some are fertile, and others are capable of mating only with certain tester strains. This preference for mating partners can potentially be explained by three possible mechanisms. First, cryptic speciation events may be occurring that restrict mating between some members of the population, as has occurred in several other fungi, such as Coccidioides immitis and Coccidioides posadasii (19). Second, a spontaneous loss of mating ability may be occurring in nature or during laboratory passage, as has recently been reported for C. neoformans serotype D strains (46). Third, alterations in the mating type locus may lead to a loss or restriction of mating capacity, and we are currently investigating this possibility by sequencing the a and
alleles of the MAT locus from strains WM276 and E566.
Targeted gene disruption using dominant selectable markers in serotypes B and C. In addition to the availability of genetic analysis, the ability to perform targeted disruptions is an essential attribute with regard to a model organism. Our studies presented here demonstrate that the Natr, Hygr, and Neor cassettes can be used as dominant selectable markers in C. neoformans var. gattii to readily disrupt genes by biolistic transformation and homologous recombination, providing valuable tools for facilitating molecular manipulation of the genome. The ability to transform a range of clinical and environmental isolates by using plasmids that can function in other varieties not only provides a tool for performing targeted disruptions in C. neoformans var. gattii but also allows the option of utilizing marker constructs and gene regulatory sequences designed for use in serotype A or D.
The Vancouver Island outbreak is attributable to an unusually fertile set of isolates.
Attention has recently focused on the primary pathogenic form of C. neoformans due to an outbreak on Vancouver Island, Canada. The presence of C. neoformans var. gattii on Vancouver Island indicates that this primary pathogen is not restricted to tropical regions. Our study reveals that, unlike isolates originating from elsewhere in the world, the strains from the Vancouver Island outbreak are exclusively of the
mating type. Furthermore, the vast majority of the outbreak isolates are fertile. This observation gives rise to several possible models. In the first, mating and meiotic recombination in a fertile clade may have given rise to an isolate with increased virulence, expanded host range, or an altered environmental niche. In the second, the fertility of the isolates may increase the production of the infectious propagule, increasing the incidence of infection. Third, the outbreak may be attributable to a so far unobserved ability of these isolates to undergo haploid fruiting, which perhaps explains the presence of exclusively
isolates. Finally, the relationship between the outbreak and the fertility of these isolates may be coincidental.
Australian environmental isolates are sterile.
In contrast to the fertility of isolates from Vancouver Island and elsewhere in the world is the infertility of the Australian environmental isolates, as we were unable to identify mating of any of these isolates. This finding supports previous reports that failed to identify recombining populations in association with eucalyptus trees (15). In contrast, 50% (three of six) of clinical isolates were fertile. These isolates may have originated elsewhere or may be due to the production of spores from rare environmental isolates. It is still possible that the conditions for mating of this subset of isolates differ from those for mating of the fertile strains identified thus far and that given appropriate conditions or mating partners these strains may be capable of undergoing sexual recombination. This represents an important avenue of study, as the C. neoformans var. gattii genome project that is currently under way uses a sterile Australian environmental isolate (WM276) (J. Kronstad, personal communication). One possibility is that these geographically isolated strains no longer have functional mating type loci. To investigate this prospect, we are currently sequencing the mating type loci of both
(WM276) and a (E566) isolates. Molecular analysis of the mating type loci of these environmental isolates may reveal the reason for this infertility, providing not only the means to render the platform sequence reference strain WM276 fertile but also insight into the fertility of strains from elsewhere in the world.
Disruption of the RGS protein-encoding gene CRG1 enhances mating of C. neoformans var. gattii.
In C. neoformans var. grubii, loss of the RGS protein Crg1 required for pheromone desensitization enhances mating. Disruption of the CRG1 gene greatly enhanced mating of both serotype C isolates and an isolate from the Vancouver Island outbreak and conferred the ability to mate with a subset of partners that appeared to be sterile when crossed with a wild-type strain. Furthermore, the crg1
mutation overrides the nutritional and desiccation signals normally required for mating. In direct contrast to strains from Vancouver Island, environmental isolates originating from Australia had no identifiable sexual cycle despite deletion of the CRG1 gene in either or both strains in crosses.
It is striking that the RGS protein mutations exert related phenotypes in the two divergent organisms S. cerevisiae and C. neoformans, enhancing pheromone responsiveness in both and enhancing mating of C. neoformans. This said, there are also interesting distinctions between the phenotypes of an S. cerevisiae sst2 mutant and the crg1 mutant of C. neoformans. In contrast to the alteration in cellular morphology and the reduced mating ability of an sst2
mutant (9, 39), crg1
strains show no alteration in growth morphology in the absence of a partner and undergo increased mating. Comparison of fungal RGS proteins reveals that all of them contain two N-terminal DEP (Dishevelled, Egl-10, Pleckstrin) domains, except the C. neoformans Crg1 protein, which appears to contain only one. In S. cerevisiae, these domains have been implicated in signaling the stress response pathway (2), and this function may have been lost in C. neoformans, perhaps explaining why crg1
mutant strains do not display any detrimental phenotypes. crg1
mutant strains therefore represent a valuable tool in the further analysis of mating and subsequent production of the infectious propagule by this primary human pathogen.
In summary, these studies provide insight into a factor that may have contributed to the outbreak on Vancouver Island and a starting point for the generation of congenic pairs of this variety. Additionally, comparison of serotype B and C, Vancouver, and Australian isolates to the opportunistic serotype A and D pathogens provides a model to address the central question of how an opportunistic organism escapes immune control and evolves into a primary pathogen.
| ACKNOWLEDGMENTS |
|---|
This work was supported in part by NIAID R01 grant AI50113 to Joseph Heitman and NIAID PO1 program project grant AI44975 to the Duke University Mycology Research Unit. Joseph Heitman is a Burroughs Wellcome Scholar in Molecular Pathogenic Mycology and an associate investigator of the Howard Hughes Medical Institute.
| FOOTNOTES |
|---|
The supplemental material for this article may be found at http://ec.asm.org/. ![]()
| REFERENCES |
|---|
|
|
|---|
protein pair in yeast. Biochemistry 37:4815-4822.[CrossRef][Medline]
and a mating types in environmental and clinical collections of Cryptococcus neoformans var. gattii strains from Australia. J. Clin. Microbiol. 37:2920-2926.
and MATa strains of the pathogenic yeast Cryptococcus neoformans. Fungal Genet. Biol. 28:1-5.[CrossRef][Medline]
isolates. Infect. Immun. 71:4831-4841.
This article has been cited by other articles:
| ||||||||||||||||||