Previous Article | Next Article ![]()
Eukaryotic Cell, June 2003, p. 465-473, Vol. 2, No. 3
1535-9778/03/$08.00+0 DOI: 10.1128/EC.2.3.465-473.2003
Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Department of Plant Pathology, University of California, Riverside, California 92521
Received 31 July 2002/ Accepted 20 February 2003
|
|
|---|
|
|
|---|
Most oomycetes, which include important parasites of plants and animals, undergo both sexual and asexual sporulation. Despite their generally filamentous, fungus-like pattern of growth, oomycetes are diploid and share a close taxonomic relationship with chrysophytes, diatoms, and brown algae rather than with true fungi (3). One of the best-known oomycetes is Phytophthora infestans, which caused the Irish potato famine in the 1840s. The late blight diseases caused by P. infestans continue to have devastating effects on agricultural production and threaten food security (12).
The physiology of sporulation in oomycetes is well described, but little is known at a molecular level. In heterothallic Phytophthora, sexual development occurs in response to hormonal interactions between A1 and A2 mating types (4, 16, 19). Male and female gametangia termed antheridia and oogonia form, and then oogonia penetrate antheridia and develop into oospores. Meiosis occurs in both gametangia, after which haploid antheridial and oogonial nuclei fuse to form a zygote within the developing oospore. Cross-walls appear, which delimit gametangia from the normally aseptate hyphae, and the oospore becomes dormant.
The induction of mating also arrests asexual sporulation, which occurs in nonmating aerial hyphae upon aging or nutrient limitation (11). This involves the differentiation of hyphal tips into sporangiophores (16, 33). Terminal swellings then form, which become the sporangia, each containing several diploid nuclei. Mitosis stops within sporangia, even though their cytoplasm remains active and undesiccated, unlike the conidia of true fungi (16). Germination usually involves cleavage of each sporangium into 6 to 12 mononucleate, motile zoospores which later encyst and extend germ tubes that transition into hyphae (15).
To enhance our understanding of sexual development, cDNAs identifying eight genes that are up-regulated during mating were isolated and partially characterized (11). Three encoded potential RNA-interacting proteins, suggesting that stabilization or degradation of RNA participates in the transition from hyphae to sexual spores. This paper focuses on one of those genes, M90, which encodes a member of the Puf family of developmental regulators that bind and inhibit translation of specific mRNAs (21, 25, 35, 36, 40). Presented are details of the structure and activity of M90, including its spatial and temporal pattern of expression during development as discerned by using a fusion between its promoter and the ß-glucuronidase (GUS) reporter gene. M90 was induced early in sexual development in both male and female gametangia. It was also induced at an early stage of development of asexual spores, which was unexpected since the two spore types are structurally and biochemically distinct (15). Interestingly, during the preparation of this paper it was reported that a Puf gene was also expressed in zoospore cysts of another oomycete, Saprolegnia parasitica (1). Although the gene was induced at a different developmental stage in S. parasitica than in P. infestans, it appears that this family of RNA-binding proteins may play a universal role in oomycete sporulation.
|
|
|---|
Characterization of gene structure. M90 was identified as a short cDNA, later found to represent nucleotide (nt) 2495 to 2879 of the primary transcript, from a subtraction library enriched for mating-specific genes (11). Genomic sequences were obtained from a BamHI subclone of an M90-containing bacterial artificial chromosome clone. The full-length cDNA sequence was ascertained by sequencing the products of reverse transcription-PCR (RT-PCR), 5' rapid amplification of cDNA ends (5' RACE), and 3' RACE performed with kits from Invitrogen (Carlsbad, Calif.) with 500 ng of total, DNase-treated RNA from mating cultures. RT-PCR internal to the transcript employed primers RT1 and RT2 (5'-CCTTCCCCCATCACGCCACCACAG and 5'-GCAGGAAGCGCAGGAGC, respectively), which bound to nt 81 to 104 and nt 2883 to 2900 of the primary transcript, respectively. 5' RACE employed gene-specific primers SP1 (5'-TGCCATAGCTCCGTCGTAAG, nt 1306 to 1287), SP2 (5'-ACTGGAGCGTGGAAAACTT, nt 874 to 856), and SP3 (5'-TAGGCGGCGTGGTCTGAGCA, nt 382 to 363). 3' RACE used an oligo(dT) primer plus gene-specific primers 3'SP1 (5'-GGAAGAGATCAGCCAGATCGTTGAC, nt 2551 to 2575) and 3'SP2 (5'GTCCTGTGCTCTACTTCCCATGATG, nt 2605 to 2629). Amplified bands were cloned into pGEMT-Easy (Promega, Madison, Wis.) prior to DNA sequencing.
Transformation of P. infestans. Transformation was performed by particle bombardment (8) with a vector containing the M90 promoter fused to the GUS reporter gene. This was made in pOGUS (Fig. 1C), a vector bearing the npt gene for G418 resistance plus GUS preceded by unique ApaI and ClaI sites. pOGUS was constructed by inserting a blunt-ended NcoI-EcoRI fragment from pHAMT35G (18) containing the GUS gene fused to the ham34 terminator of Bremia lactucae into EcoRV-EcoRI-digested pHAMT35N/SK. The latter was constructed by inserting a blunt-ended HindIII-EcoRI fragment from pHAMT35N (18) into SspI-digested pBluescript SK2(+) (Stratagene, La Jolla, Calif.). The M90 promoter was inserted upstream of the GUS gene in pOGUS as a 1.38-kb PCR fragment with added ApaI and ClaI sites which was obtained by using primers P1 (5'-AAGGGGCCCAACTTCGGGTGCTGGCTC) and P2 (5'-GGATCGATGGAGTGTGGGCG GTTGCTG). This fragment included bases -1345 to +31 relative to the M90 transcription start site. Assays for GUS activity were performed as described previously (18).
![]() View larger version (10K): [in a new window] |
FIG. 1. Structure of M90 and the vector used for promoter analysis. (A) Linearized map of the M90 gene. The transcribed region is represented by an open box, which starts at position +1. Filled boxes (I1 and I2) represent introns. Also indicated are the suggested translation start site at nt +30, the stop codon (TGA) at nt +2801, and a16-nt motif present near the transcription start point in most oomyceteous genes (OO) between nt -68 and -50 (30). Restriction sites are ApaI (A), BamHI (B), EcoRI (E), KpnI (K), ClaI (L), PstI (P), SacI (S), EcoRV (V), and XmaI (X). The triangles represent the primers used to amplify the promoter (P1, nt -1345 to -1327; P2, nt +31 to +11). (B) Representation of M90 transcript. The eight black and two grey boxes indicate, respectively, the regions encoding the eight conserved repeats and the two flanking motifs (Csp1 and Csp2) that are conserved in Pum-HD. (C) Linearized map of pOGUS. Inserted within a pBluescript SK(+) (pSK) backbone are the GUS gene, the neomycin phosphotransferase (npt) gene, and the ham34 promoter and transcriptional terminator sequences (5'ham and 3'ham, respectively) from B. lactucae. Two unique cloning sites, ApaI (A) and ClaI (L), are indicated.
|
Mating cultures for RNA extractions utilized rye A agar covered with polycarbonate membranes (0.4-µm pore size), upon which parallel strips of A1 and A2 inocula were placed separated by 2 cm. Oospores were from 22-day mating cultures, which were homogenized five times for 2 min each in 50 ml of extraction buffer at 4°C in a Brinkman Polytron (speed 7) and passed through a 100-µm nylon mesh. The oospores, which remained intact after this treatment, were concentrated by centrifugation for 10 min at 2,000 x g, washed three times with extraction buffer, resuspended in 0.3 ml, and ground in liquid nitrogen prior to RNA extraction. RNA from a self-fertile strain was obtained by using the polycarbonate procedure or rye broth cultures.
Nonmating RNA was extracted from single isolates grown on polycarbonate cultures, which supported the development of asexual spores. Nonsporulating, submerged cultures were from 4-day rye broth cultures inoculated with sporangia. Carbon- and nitrogen-starved cultures were obtained by passaging hyphal mats from 3-day rye broth cultures through two water washes, followed by 15 h of incubation in defined medium lacking glucose or (NH4)2SO4. Sporangia were isolated from 6-day polycarbonate rye cultures by vortexing the hyphal mats in water, purifying the sporangia through a 70-µm nylon mesh, and concentrating the filtrate by centrifugation at 1,000 x g for 5 min. Directly germinated sporangia were prepared after incubation at 18°C for 10 h in half-strength rye broth, followed by centrifugation at 1,000 x g. Zoospores were prepared by incubating sporangia in water at 10°C for 3 h, followed by passage through a 15-µm nylon mesh and concentration of the filtrate by centrifugation at 400 x g at 4°C for 5 min. Germinated zoospore cysts were obtained by vortexing zoospores in 1 mM CaCl2 for 30 s, followed by incubation for 4 h in half-strength rye broth at 18°C and centrifugation at 1,000 x g.
Blot analysis. RNA blotting was performed with ethidium bromide-stained total RNA and 1.2% agarose-6.6% formaldehyde gels (27). The RNA was transferred to nylon membranes by capillary blotting in 10x SSPE (1.8 M NaCl, 0.1 M NaHPO4, 0.01 M EDTA [pH 7.7]) and fixed by UV cross-linking. DNA blotting was with 0.8% agarose gels in 1x TBE (89 mM Tris, 89 mM H3BO3, 2 mM EDTA) and alkaline blotting to nylon membranes.
Hybridizations were performed with 32P-labeled randomly primed probes (18). Probes were made from either a KpnI-XmaI fragment of the M90 gene (nt 208 to 3362) (Fig. 1), a genomic actin clone (actA), or cDNA clones for elongation factor-1 (Ef1) or 28S rRNA. Signals were detected by phosphorimager analysis and quantified by using the Quantity One software for Macintosh (Bio-Rad, Richmond, Calif. High-stringency washes were in 0.2x SSPE-0.2% (wt/vol) sodium dodecyl sulfate-0.1% (wt/vol) sodium pyrophosphate at 65°C. Low-stringency washes were in 1x SSPE-0.2% sodium dodecyl sulfate-0.1% sodium pyrophosphate at 55°C.
Sequence analysis. Protein alignments were performed by using ClustalW on the BCM Search Launcher (http://dot.imgen.bcm.tmc.edu:9331/multi-align/multi-align.html) and formatted by using BOXSHADE (http://www.ch.embnet.org/software/BOX_form.html). This involved Puf family members from Arabidopsis thaliana (GenBank accession number AAC95216), Homo sapiens (BAA07895), Populus tremula x Populus tremuloides (AAF71823), and Xenopus laevis (BAB20864) and FBF2 from Caenorhabditis elegans (Q09312), PufA from Dictyostelium discoideum (AAD39751), Pumilio from Drosophila melanogaster (P25822), Pum2 from Mus musculus (NM030723), Puf3 and Puf5 from Saccharomyces cerevisiae (S64195 and S64016), and Puf1 from Saprolegnia parasitica Puf1 (CAC48394). Similarity was measured by using the Blast 2 Sequences program (http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html).
Analysis of the M90 promoter for overrepresented oligonucleotides was performed with the Gibbs Motif Sampler, Oligo Analysis, and Dyad Detector programs (http://embnet.cfin.unam.mx/rsa-tools/). Searches for promoter elements were performed with Proscan version 1.7 (http://bimas.dcrt.nih.gov/molbio/proscan/) and TRES (Transcription Regulatory Element Search [http://bioportal.bic.nus.edu.sg/tres.html]).
Nucleotide sequence accession number. The sequence of the M90 gene has been deposited in GenBank under accession number AF507056.
|
|
|---|
A search of the promoter for potential transcription signals identified, between nt -68 and -50, a sequence matching the GCTCATTYYNCAATTT element present in several other oomycete genes (Fig. 1A) (30). No matches to transcription factor sites in the Proscan and TRES databases were detected, although it should be noted that no such sequences have yet been defined in oomycetes. An analysis of the M90 promoter and coding region along with two other mating-induced genes by using the Oligo Analysis, Dyad Detector, and Gibbs Motif Sampler programs did not reveal significantly overrepresented motifs that might represent transcription factor binding sites.
M90 encodes a member of the Puf protein family. An open reading frame corresponding to 875 amino acids, which encoded a 97.5-kDa protein, was detected within the M90 transcript. Two in-frame methionine codons were present at +30 and +48 in the contexts of TCCATGG and TCGATGA, respectively. The former is suggested to be the predominant start site, since it is a better match to the A-ATGG sequence that is optimal for translational initiation in eukaryotes (20).
The predicted protein closely matches the Puf family of proteins, which was initially defined by Pumilio of D. melanogaster (25) and FBF of C. elegans (21). These proteins bind the 3' untranslated regions of target mRNAs, resulting in translational repression (39, 40). Each Puf protein contains a highly conserved RNA-binding region named Pum-HD (Pumilio homology domain) flanked by nonconserved sequences. These features are conserved in the P. infestans protein (Fig. 1B and 2). In P. infestans, Pum-HD resides between amino acids 513 and 868, contains the standard eight RNA-binding motifs, and is flanked by two other sequences (Csp1 and Csp2) found in most Puf proteins. The eight repeated motifs show the consensus ll.Lm.D.YGNrVIQk.LEhA, where upper- and lowercase letters represent amino acids that are identical and conserved in at least half of the repeats, respectively, and periods represent nonconserved residues.
![]() View larger version (78K): [in a new window] |
FIG. 2. Relationship of the predicted M90 protein to other members of the Puf family. (A) Comparison of 12 Puf proteins and similarity within the RNA-binding domain. The full-length sequence is represented by the open box, black boxes represent the Pum-HD motifs, and grey boxes represent the Csp1 and Csp2 regions. The percent identities to M90 within the numbered region are shown above the respective sequences. For example, amino acids 425 to 766 of S. parasitica Puf1 show 51% identity to the amino acids 515 to 868 of M90. Accession numbers are listed in Materials and Methods. (B) Amino acid alignment of the eight Pum-HDs (R1 to R8) and two Csp domains (Csp1 and Csp2) in Puf proteins. Amino acids that are identical or conserved in 50% of the sequences are shown by black or grey shading, respectively.
|
Pumilio is represented by a single-copy gene in P. infestans. Most organisms produce multiple Puf-like proteins from either diverged members of small gene families or isoforms from a single gene (28, 29, 37, 40), although there are exceptions (1). To test whether multiple M90-like sequences were in P. infestans, blot analysis was performed at low stringency against genomic DNA digested with SacI, EcoRV, or PstI (Fig. 3). Accounting for the digestion of some of the enzymes within the gene, the data indicated that a single Puf-like gene was present.
![]() View larger version (52K): [in a new window] |
FIG. 3. DNA blot analysis of M90. Two micrograms of genomic DNA from isolates 8811 and 618 of P. infestans were digested with EcoRV (V), PstI (P), and SacI (S) and then electrophoresed, blotted, hybridized with a KpnI-XmaI DNA fragment corresponding to nt +208 to 3362 of M90, and washed at low stringency as described in Materials and Methods. Size standards obtained with a 1-kb ladder (Invitrogen) are indicated on the left.
|
![]() View larger version (80K): [in a new window] |
FIG. 4. RNA blot analysis of M90 during mating. The diagram in the upper left corner illustrates the setup of mating reactions between isolates 8811 and 618, labeled with the positions of A1 and A2 inocula, the mating zone (M), and the region outside the mating zone (OM). Six micrograms of total RNA was electrophoresed, blotted, hybridized, and washed at high stringency as described in Materials and Methods. A photograph of the ethidium bromide (EtBr)-stained RNA and hybridization signals against probes for M90, Ef1, actin, and 28S rRNA are shown. (A) RNA from the mating zones of cultures after 4, 7, and 11 days (lanes M4, M7, and M11, respectively). Shown at the bottom are the ratios of M90 signal intensity to Ef1, actin, or rRNA; values are standardized to M11, which was set at 100. (B) RNAs from a separate experiment from the mating zone after 5, 8, 13, and 16 days (lanes M5, M8, M13, and M16, respectively) and outside the mating zone after 5, 8, 13, and 16 days (lanes OM5, OM8, OM13, and OM16, respectively). Also tested were RNAs from purified 8811 x 618 oospores (lane Oo), self-fertile strain 6.11 forming oospores on a polycarbonate membrane culture (lane SF-Oo+), 6.11 from submerged cultures where oospores were not formed (lane SF-Oo-), and individual 15-day cultures of 8811 and 618 producing asexual sporangia (lanes A1Sp and A2Sp, respectively). M90/Ef1, M90/28S, and M90/actin ratios are shown at the bottom, standardized to the maximum ratio, which was set at 100.
|
M90 was also expressed in a self-fertile (homothallic) strain of P. infestans grown on agar medium, a condition conducive to oosporogenesis (Fig. 4B, lane SF-Oo+). M90 RNA was less abundant in the self-fertile strain than in normal interisolate matings, which was consistent with observations that the self-fertile strain produced fewer oospores. That transcript accumulation in the self-fertile strain, as well as in normal matings, was due to oospore formation and not to aging was demonstrated by the absence of M90 RNA in a 15-day culture of the self-fertile strain maintained under submerged conditions, which suppress oospore formation (Fig. 4B, lane SF-Oo-).
Experiments were also performed to compare M90 RNA levels in the zone between the A1 and A2 parents with those in the region external to the inoculum strips, where few oospores develop. One initial reason for doing this was to test whether diffusion of mating hormones through the culture affected gene expression. M90 RNA was easily detected in the region external to the mating zone, even though no oospores had formed (Fig. 4B, OM ["outside mating"] lanes). Although explanations for this included the transduction of a mating signal through the medium or hyphal cytoplasm, subsequent experiments indicated that the gene was induced during asexual sporulation.
M90 is also transcribed during asexual sporulation. While asexual sporulation is prevented within regions of cultures showing a mating response (11), asexual spores will form in the outside-mating region after 4 to 5 days, as is also the case in single-isolate cultures. That the M90 signal in the nonmating region was due to asexual sporulation was suggested by the detection of transcripts in 15-day cultures of the A1 and A2 parents grown separately, in which asexual sporulation had occurred (Fig. 4B, lanes A1Sp and A2Sp).
Tests of other developmental stages helped show that the accumulation of M90 RNA was attributable to asexual sporulation and not just to aging (Fig. 5). This involved analyses of RNAs from purified asexual sporangia, sporangia directly germinated in media for 18 h, zoospores released from sporangia in water, zoospores encysted and germinated in media for 4 h, and mycelia grown under submerged conditions, which prevents asexual sporulation. High levels of M90 RNA were detected in sporangia and zoospores. However, once these spores were allowed to germinate and start elaborating hyphae, the M90 signal fell >50-fold. Although these conclusions held regardless of whether Ef1, actin, or rRNA was used as a loading standard, it was interesting that the abundances of both Ef1 and actin RNA relative to rRNA declined in sporangia and zoospores compared to hyphae. Consequently, the levels of induction of M90 calculated in Fig. 5 may be overestimates.
![]() View larger version (44K): [in a new window] |
FIG. 5. Measurement of M90 RNA in nonmating samples. Blots were prepared by using RNA from sporangia purified from 6-day cultures of isolate 1306 (lane Sp), sporangia germinated for 10 h in rye broth (lane GermSp), zoospores released from sporangia after 3 h (lane Zoo); encysted zoospores germinated for 4 h in rye broth (lane GermZoo), nonsporulating mycelia from a 4-day rye broth culture (lane NonSp), and nonsporulating mycelia from defined medium (lane Dm), defined medium lacking the normal (NH4)2SO4 nitrogen source (lane Dm-N), and defined media lacking glucose (lane Dm-C). The blots were prepared and analyzed as described in the legend to Fig. 4, including calculation of the relative levels of the M90 signal versus Ef1, actin, and 28S rRNA controls. EtBr, ethidium bromide.
|
M90 is expressed in male and female structures during mating. A fusion between the M90 promoter and the GUS reporter gene was expressed in transformants to address the spatial and temporal patterns of M90 expression. This was expected to be informative, since sexual development occurs asynchronously and thus extrapolation of the developmental stage(s) of expression from RNA blot data can be challenging. For example, after 8 days a mating culture contains a mixture of structures, including A1 hyphae not yet responding to the A2 and vice versa, hyphae swelling in response to mating hormones, young and old antheridia and oogonia (including those in pre- and postmeiotic stages), young oospores containing zygotic nuclei, nearly mature oospores, and hyphae connected to mating structures. Also, GUS fusions would provide data on M90 expression independent of the RNA blot analysis, in which some ambiguity resulted from the observation that normalization standards such as actin and Ef1 varied during different stages of growth and development.
To learn where M90 transcripts accumulate, DNA from nt -1345 to +31 relative to the transcription start site was fused to GUS in a G418 resistance-conferring vector and transformed into A1 and A2 isolates. Transformants and nontransgenic partners were then mated in combinations in which GUS was predicted to be expressed only in male or female structures, due to the system of sexual preference (relative sexuality) in Phytophthora (17). For example, A2 isolate 618 forms only male structures when coupled with A1 strain 1306 but acts female when crossed with 8811. Preliminary analyses of transformants in single cultures and mating reactions indicated that the 1.38-kb promoter fragment conferred the expected pattern of expression: GUS was present during mating but not in vegetative hyphae. As described below, GUS was also expressed during asexual sporulation.
The pattern of GUS staining during mating indicated that M90 accumulation began early during both male and female development (Fig. 6). In crosses of GUS-positive 8811 (male) with GUS-negative 618 (female), strong staining was observed in hyphal swellings representing antheridial primordia prior being penetrated by oogonia (Fig. 6A). It was not always obvious that such swellings were going to develop into antheridia, but this was predicted since GUS was being expressed only by the male strain. Occasionally some blue coloration was noted in adjacent hyphae, but this was probably due to leakage of the cleaved GUS substrate. At a more advanced phase of sexual development, staining was observed in antheridia attached to oogonia (Fig. 6B and C). In some instances a short hyphal fragment attached to antheridia also stained (Fig. 6D). This likely represents an intermediate stage in development preceding the completion of cytoplasmic migration into the antheridium, rather than leakage of GUS, since stained hyphae were never observed adjacent to more mature oogonia or oospores.
![]() View larger version (108K): [in a new window] |
FIG. 6. Histochemical staining of GUS activity in transformants of P. infestans expressing a fusion between the M90 promoter and the GUS gene. (A to D) Matings between a transgenic derivative of 8811 (A1) and nontransgenic 618 (A2), in which 8811 acted male. The interpretative diagram for panel A shows the outline of antheridial initials (ai); the leftmost structure is intertwined with a hypha of uncertain origin. The diagram for panel D shows the antheridial hyphae (ah), antheridia (a) wrapped around the oogonial stalk, and the fully expanded oogonium (o). (E to H) Matings between a transgenic derivative of 1306 (A1) and nontransgenic 618 (A2), in which 1306 acted female. The diagram for panel E shows a young interaction between an oogonium (o) and antheridium (a), and that for panel G shows the oogonial hyphal donor (oh). (I to L) Cultures of transgenic derivatives of 88069 (I) and 618 (J to L) undergoing asexual sporulation. The diagram for panel J shows developing sporangia (s) upon a branched sporangiophore (sp) and a vacuolated (v) boundary forming between a sporangium and a sporangiophore. Panel L shows GUS-stained sporangia detached from sporangiophores and a lysed or germinated spore case devoid of cytoplasm. (M) Transformant expressing GUS behind the ham34 constitutive promoter, showing staining in spores and hyphae as a control. (N) Mating between the same transformant as in panel M and nontransgenic 618, showing staining in spores and hyphae as a control. (O) Nontransformed strain.
|
GUS staining was not detected in mating cultures in hyphae that were unattached to antheridia or gametangia, indicating that M90 expression is narrowly localized to regions undergoing sexual differentiation (Fig. 6B and E to H). As a control, matings that involved a transformant expressing GUS behind the constitutive ham34 promoter (18) were examined. In such cases, blue-stained hyphae were common throughout the culture (Fig. 6N).
The M90 promoter is active during asexual sporulation. The GUS-expressing strains were also used to study M90 expression during asexual sporulation (Fig. 6I to M). This revealed that the gene was induced early in the pathway. As described previously (24), sporulation begins when a fraction of hyphal tips evolve into sporangiophores, which are often branched. Apical swellings then develop, cytoplasm and nuclei flow into the swellings, and basal septa form between the sporangiophore and each sporangium. These stages are evident in Fig. 6I, which portrays a hyphal tip presumably developing into a sporangiophore; in Fig. 6J, which shows GUS-staining cytoplasm in both the sporangiophore and young sporangia; in Fig. 6K, where GUS activity is restricted to the sporangia after septation; and in Fig. 6L, which shows mature sporangia detached from the sporangiophore. It was interesting that there was an unstained region near the base of a nearly mature sporangium (Fig. 6J, left). This represents an incipient region of vacuolization, which, along with septation, occurs at the time sporangia become fully developed. Staining was also observed in zoospores released from sporangia (not shown).
M90 (GUS) accumulation appears to be specific to hyphae undergoing sporulation, as regions of aerial cultures not yet competent to sporulate showed no staining (Fig. 6O), and staining was never observed in submerged hyphae in which sporulation does not occur (not shown). Also, vegetative hyphae near sporangiophores did not stain (Fig. 6I). As a positive control, a transformant with the constitutively expressed GUS gene displayed staining in hyphae as well as spores (Fig. 6 M).
|
|
|---|
Most proteins in the family are unrelated outside Pum-HD and participate in distinct developmental processes, usually by repressing the translation of specific mRNAs (14). For example, Pumilio together with Nanos and Brat repress translation of hunchback mRNA to determine cell types in the Drosophila embryo (14, 35). Similarly, Pumilio and Nanos-like proteins repress the translation of an mRNA involved in the sperm-oocyte transition in C. elegans (21). However, rather than targeting a specific mRNAs the P. infestans protein may exhibit a general RNA-binding activity that protects transcripts in oospores or sporangia until germination. In true fungi and plants, spores and seeds contain preformed mRNAs that are stabilized largely by desiccation (23, 32). However, in oomycetes where spores remain hydrated, other mechanisms such as RNA-binding proteins may be required for RNA stabilization.
Interestingly, one function of Puf that may be conserved between species involves regulation of mitosis. In Drosophila and Xenopus, Puf proteins down-regulate the translation of cyclin B, which normally allows mitotic entry (26, 34, 35). This may explain why M90 is expressed during both sexual and asexual sporulation in P. infestans. Although these processes are dissimilar biochemically and structurally, both involve coordinated nuclear divisions followed by mitotic dormancy (4, 24).
A connection with nuclear dormancy can also be made from a report that a Puf gene is transcribed during certain spore stages of the oomycete S. parasitica (1). There were significant differences in the expression of the Puf-like gene compared to that in P. infestans, however. Transcripts appeared in S. parasitica only at the final stages of sporangial maturation, but they appeared in P. infestans before morphological differentiation was evident. Also, zoospores retained the transcript in P. infestans but lacked it in S. parasitica, although it reappeared after zoospore encystment in the latter. Such discrepancies may be attributed to differences in the biology of the spore cycles in the two species, which are widely separated within the oomycete group based on rRNA-based taxonomies (9). Alternatively, it cannot be assumed that the two Puf proteins are homologues, since they have little similarity outside of the Pum-HD.
Our interest in M90 has two dimensions: understanding its protein product and identifying factors that govern its activity. In most other species, Puf proteins are expressed in all cell types and are regulated primarily by tissue-specific combinatorial interactions with proteins such as Nanos (14). In contrast, in P. infestans the spatial and temporal patterns of M90 expression are regulated at the level of transcription. The M90 promoter, which is the first developmentally regulated promoter isolated from an oomycete, provides a means for identifying transcription factors and signal transduction pathways regulating sexual and asexual sporulation. Being able to understand and manipulate these pathways has implications related to protecting crops and animals from disease.
This work was supported by awards from the National Science Foundation (MCB-0109933) and the U.S. Department of Agriculture (2002-02658).
|
|
|---|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»