Eukaryotic Cell
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, X.
Right arrow Articles by Michels, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, X.
Right arrow Articles by Michels, C. A.

 Previous Article  |  Next Article 

Eukaryotic Cell, October 2002, p. 696-703, Vol. 1, No. 5
1535-9778/02/$04.00+0     DOI: 10.1128/EC.1.5.696-703.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Intracellular Maltose Is Sufficient To Induce MAL Gene Expression in Saccharomyces cerevisiae

Xin Wang, Mehtap Bali, Igor Medintz,{dagger} and Corinne A. Michels*

Queens College and Graduate School of City University of New York Biology Department, Flushing, New York 11367

Received 10 May 2002/ Accepted 26 June 2002


    ABSTRACT
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The presence of maltose induces MAL gene expression in Saccharomyces cells, but little is known about how maltose is sensed. Strains with all maltose permease genes deleted are unable to induce MAL gene expression. In this study, we examined the role of maltose permease in maltose sensing by substituting a heterologous transporter for the native maltose permease. PmSUC2 encodes a sucrose transporter from the dicot plant Plantago major that exhibits no significant sequence homology to maltose permease. When expressed in Saccharomyces cerevisiae, PmSUC2 is capable of transporting maltose, albeit at a reduced rate. We showed that introduction of PmSUC2 restores maltose-inducible MAL gene expression to a maltose permease-null mutant and that this induction requires the MAL activator. These data indicate that intracellular maltose is sufficient to induce MAL gene expression independently of the mechanism of maltose transport. By using strains expressing defective mal61 mutant alleles, we demonstrated a correlation between the rate of maltose transport and the level of the induction, which is particularly evident in medium containing very limiting concentrations of maltose. Moreover, our results indicate that a rather low concentration of intracellular maltose is needed to trigger MAL gene expression. We also showed that constitutive overexpression of either MAL61 maltose permease or PmSUC2 suppresses the noninducible phenotype of a defective mal13 MAL-activator allele, suggesting that this suppression is solely a function of maltose transport activity and is not specific to the sequence of the permease. Our studies indicate that maltose permease does not function as the maltose sensor in S. cerevisiae.


    INTRODUCTION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Saccharomyces cerevisiae responds to the presence of a wide variety of environmental nutrients via sensing and signaling pathways capable of identifying the nutrients, determining their approximate concentrations, and integrating the information from these several signals to regulate gene expression and cell growth, proliferation, and morphology. Few nutrient or metabolite sensors have been identified despite extensive efforts in a variety of regulated systems. For the most part, those nutrient sensors identified to date fall into two categories: integral membrane receptor-like proteins and cytoplasmic nutrient/metabolite-binding proteins. Reports suggesting a dual role for certain nutrient transporters as both transporters and sensors have been presented, but conclusive evidence for such, in the form of constitutive alleles of the transporter genes, is lacking (20).

We are interested in identifying the Saccharomyces maltose sensor. Previous studies demonstrated that maltose permease plays an essential role in maltose induction of MAL gene expression (5). Moreover, the ability of an {alpha}-glucoside sugar to serve as an inducer of MAL gene expression appears to be dependent on the substrate specificity of the transporter (15). These results suggested the possibility that the Saccharomyces maltose permease can also play the role of the maltose sensor.

Five nearly identical MAL loci have been identified in S. cerevisiae, each located at a telomere-associated site: MAL1 (chromosome VII), MAL2 (chromosome III), MAL3 (chromosome II), MAL4 (chromosome XI), and MAL6 (chromosome VIII) (7). Different maltose-fermenting strains carry at least one of these fully functional alleles, but often two or more loci are present in a strain (27). A typical MAL locus is a cluster of three genes, all of which are required for maltose fermentation. Gene 1 encodes maltose permease, a member of the 12-transmembrane domain family of sugar transporters; gene 2 encodes maltase, an {alpha}-glucoside hydrolase; and gene 3 encodes the MAL-activator, a DNA-binding transcription activator of the MAL genes (7). Genetic nomenclature uses both the locus number and the gene number. For example, MAL61 encodes maltose permease at the MAL6 locus. Natural variants of MAL1 and MAL3 containing nonfunctional alleles of gene 1 or gene 3 have been identified in strains from the wild and in common laboratory strains (6, 26). Induction of the MAL structural genes requires an inducer, usually maltose, but certain other {alpha}-glucosides will also act as inducers in strains encoding an appropriate transport protein, such as maltose permease, and the MAL-activator (5, 15). Does maltose permease function simply for the accumulation of intracellular maltose, whose presence is then monitored by some other mechanisms, or is maltose permease itself a maltose sensor capable of responding to extracellular maltose by initiating an intracellular signal?

Integral membrane proteins, particularly transporter-like homologues, are known to be utilized as sensors (34). Well-studied examples are Snf3p and Rgt2p, integral membrane receptors that sense, respectively, low and high extracellular concentrations of glucose (18). The Snf3 and Rgt2 proteins are structural and sequence homologues of the Hxt glucose transporters but are distinguished from the Hxt proteins by the presence of a long C-terminal cytoplasmic domain. Dominant gain-of-function mutations of SNF3 and RGT2 cause constitutive expression of the HXT genes. Moreover, the HXT genes cannot restore the signaling defect of SNF3- or RGT2-null mutations, and neither Snf3p nor Rgt2p is able to function as a glucose transport protein. Thus, although transporter like, Snf3p and Rgt2p appear to serve solely as glucose sensors (18).

Additional members of the sugar transporter superfamily with unique structural features similar to those of Snf3p and Rgt2p have been identified as putative sugar sensors in other eukaryotes. The Rco3 protein, a regulator of conidiation in Neurospora crassa (22), and the Mst1 protein from Amanita muscaria (28) appear to act as glucose sensors. Arabidopsis SUT2 has been proposed to encode a sucrose sensor in sieve element cells (1).

Utilization of transporter-like proteins as nutrient sensors is not unique to sugars. The Saccharomyces Ssy1 protein is a member of the large superfamily of amino acid permeases but is distinguishable from these permeases by its elongated N-terminal cytoplasmic domain (17). This cytoplasmic extension is reminiscent of the C-terminal domain of Snf3p and Rgt2p, but no shared sequence homology has been identified. Results suggest that the Ssy1 protein functions as a sensor of extracellular amino acids, including leucine, isoleucine, and tryptophan. Similar to Snf3p and Rgt2p, Ssy1p requires the F-box protein Grr1p as a downstream effector in the amino acid signaling pathway.

Recent reports suggest that members of the G protein-coupled receptor class of proteins also function as glucose receptors in fungi. Saccharomyces GPR1 encodes a member of the seven-transmembrane domain family of G protein-coupled receptors that includes Ste2p and Ste3p, the mating type pheromone receptors (9, 10, 19, 21, 38). In conjunction with its G protein alpha subunit Gpa2p, Gpr1p regulates pseudohyphal differentiation in response to glucose. The git3 gene of Schizosaccharomyces pombe encodes another member of the G protein-coupled receptor family responsible for monitoring of extracellular glucose (36). Interestingly, both the Saccharomyces GPR1-dependent pathway and the S. pombe git3-dependent pathway regulate the activity of cyclic-AMP-dependent protein kinase, in particular, the Saccharomyces Tpk2p isoform (21, 36, 39).

S. cerevisiae also utilizes intracellular nutrient sensors. The Snf1 protein kinase signaling pathway responds to high rates of glucose metabolism, possibly by monitoring changes in the ATP/AMP ratio produced by rapid glycolysis (4). Snf1 protein kinase is the catalytic subunit of a large protein complex that exhibits homology to mammalian AMP-activated protein kinases. It has been proposed that this kinase complex is the metabolite sensor, but this remains to be demonstrated in S. cerevisiae. The Saccharomyces Gal3 protein, a homologue of galactokinase (Gal1p), is the galactose sensor. Binding of galactose to Gal3p promotes Gal3p-Gal80p interaction, thereby releasing the Gal4p transcription activation domain from Gal80p repression (33). Recent reports indicate that the Gal3p-Gal80p interaction occurs in the cytoplasm exclusively and effectively shifts the subcellular localization of Gal80p from the nucleus to the cytoplasm in the presence of galactose (30).

In the context of these studies on nutrient sensing in Saccharomyces and other fungi, we proposed to explore the role of the maltose transport protein, maltose permease, in the regulation of MAL gene expression. Our approach to resolving questions regarding the role of maltose permease in maltose sensing is based on the assumption that, if maltose permease were also to serve as a maltose sensor, this function would require specialized sequence features of maltose permease protein that could not be replaced by a heterologous protein capable of maltose transport. For this study, we chose to use the high-affinity sucrose transporter from Plantago major encoded by PmSUC2 (13). The PmSUC2 protein is a member of the 12-transmembrane domain superfamily of sugar transporters, and although it exhibits little sequence homology with the Saccharomyces maltose permease, it is capable of transporting maltose, albeit at lower affinity. We report here that expression of PmSUC2 in Saccharomyces restores maltose-inducible MAL gene expression to maltose permease-null mutants. Moreover, by other parameters explored in this study, we show that the PmSUC2 transporter is able to fully replace maltose permease as a regulator of MAL gene expression.

(This work was carried out in partial fulfillment of the requirements for the Ph.D. degree from the Graduate School of the City University of New York [X.W., M.B., and I.M.].)


    MATERIALS AND METHODS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Yeast strains. The strains used in this study are listed in Table 1. CMY1001 has been described by Medintz et al. (23). It contains a single MAL1 locus at which the MAL11 maltose permease gene is replaced by hemagglutinin (HA)-tagged MAL61. No other MAL genes are present in this strain. Strain CMY1050 is a MAL61/HA-null derivative of CMY1001 and was constructed by the PCR-based gene disruption described by Medintz et al. (24). Strain CMY1061 is a MAL13 deletion disruption of CMY1050 and was constructed as follows. The appropriate upstream (5'-CCATGTAATCGCTGCATTCAGCGCAATTTGAACTGCACTCAGCTGAAGCTTCGTACGC) and downstream (5'-CGGTGCAAACAATAGTATGTCATGATTCGAAATATGTCGGCATAGGCCACTAGTGGATCTG) primers were used to amplify the G418 resistance marker gene with pFA2-kanMX2 as the template (35). Bases homologous to the template are underlined. The resulting PCR product, which has homology to the MAL13 sequence at both the 5' and 3' ends of the open reading frame, was then used for one-step replacement of MAL13. Candidate disruptants were confirmed by PCR analysis.


View this table:
[in this window]
[in a new window]
 
TABLE 1. S. cerevisiae strains used in this study

 
A similar PCR-based process was used to construct CMY1071 (mal13{Delta}::G418), CMY1072 (mal33{Delta}::HygB), and CMY1073 (mal13{Delta}::G418 mal33{Delta}::HygB) in strain YPH500. Strain YPH500 is isogenic to S288C, and primers for the deletion of mal13 and mal33 were determined on the basis of the sequence of S288C, which is available at the Saccharomyces Genome Database website (http://genome-www.stanford.edu/Saccharomyces/). The primers 5'-ACTTTAACTAAGCAAACATGCGCCAAGCAGGCATGCGACTGCTGTCGATCAGCTGAAGCTTCGTACGC and 5'-ATCAAGGGTCTATGTCTTCATTATCCTTGGGATAACCATCCAATTGTAAAGCATAGGCCACTAGTGGAT were used to amplify G418R for mal13 disruption. Primers 5'-ACTTTAGTCAAGTATGCATGCGACTATTGTCGTGTCCGTCGAGTAAAGTGCAGCTGAAGCTTCGTACGC and 5'-AGGAATTATGTCGTCTTCATCTTTGGAATCATCATTTAGGCGCAGTGGTCGCATAGGCCACTAGTGGAT were used to amplify HygR for mal33 disruption.

Plasmid construction and mutagenesis. MAL61/HA was constructed from MAL61 by inserting a 12-codon sequence containing a single of copy of the HA epitope tag at the 5' end of the open reading frame (23). MAL61/HA was subcloned into pUN30, yielding pMAL61/HA. The native MAL61 promoter in pMAL61/HA was removed and replaced with the ADH1 promoter at the -12-bp position of MAL61, yielding pADH1-MAL61/HA, which has been described by Medintz et al. (24). Plasmids pMAL61/HA and pADH1-MAL61/HA were used as templates for in vitro mutagenesis with a Bio-Rad Mutagene Kit (Bio-Rad, Richmond, Calif.) to construct pMAL61/HA({Delta}61-90) (25), pMAL61/HA({Delta}571-580), pADH1-MAL61/HA({Delta}61-90), pADH1-MAL61/HA({Delta}571-580), and a series of C-terminal nonsense mutations (pMAL61/HA-581NS, pMAL61/HA-575NS, pMAL61/HA-570NS, and pMAL61/HA-560NS).

Plasmid pPTE18 was obtained from Norbert Sauer, University of Regensburg, Regensburg, Germany. PmSUC2 cDNA encoding a P. major sucrose transporter was ligated into the EcoRI site of vector NEV-E, yielding pPTE18 (13). Expression of PmSUC2 is controlled by the S. cerevisiae PMA1 promoter.

Maltose transport assay. Maltose transport was measured as the rate of uptake of 1 mM [14C]maltose as described by Cheng and Michels (8) and Medintz et al. (23). Assays were done in duplicate on two or three transformants. Vmax was determined by Lineweaver-Burk analysis as described by Medintz et al. (23). Maltose transport activity and Vmax are expressed as nanomoles of maltose transported per milligram of cells per minute.

Maltase assay. Maltase activity was determined in total cell extracts as described by Dubin et al. (11). Activity is expressed as nanomoles of p-nitrophenyl ß-D-glucoside (PNPG) hydrolyzed per milligram of total protein per minute. The values reported are averages of duplicate assays obtained with extracts from at least two separate cultures.

Western blot analysis. Western blot analysis was carried out as described previously (23). Mal61/HA protein was detected by using anti-HA-specific antibody, the Vistra-ECF kit (Amersham), and the Storm 860 image analyzer (Molecular Dynamics). Relative protein levels were determined by using the Storm 860 image capture software. Western blot analysis was done in duplicate on extracts prepared from duplicate experiments carried out with at least two independent transformants.


    RESULTS
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PmSUC2 suppresses the noninducible phenotype of a maltose permease deletion. CMY1001 is a maltose-fermenting strain containing MAL1 as the sole MAL locus (23). The MAL1 locus of CMY1001 encodes maltose permease (MAL61/HA), maltase (MAL12), and the MAL activator (MAL13). Charron et al. (5) showed that loss of either maltose permease or the MAL activator blocks maltose induction of MAL gene expression but loss of maltase has no obvious effect on induction. MAL61/HA was deleted from strain CMY1001 to create CMY1050 (mal61{Delta}::HIS3), and maltose induction of maltase expression was determined (Table 2). Under uninduced conditions (3% glycerol, 2% lactate), CMY1001 expresses a low but significant level of maltose transport activity (0.17 nmol/min/mg [dry weight] of cells). Deletion of the maltose permease gene reduces this rate to a background rate of 0.09 nmol/min/mg that probably represents the nonspecific low-affinity binding activity described by Benito and Lagunas (2) and not true transport. Table 2 also confirms that maltose induction is dependent on maltose permease. A 6-h induction period is sufficient for full induction of maltase expression in CMY1001, while permease deletion strain CMY1050 exhibits no induction during the same period.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Effect of PmSUC2 on expression of MAL genesa

 
PmSUC2 encodes a sucrose transporter from P. major that is a member of the 12-transmembrane domain family of sugar transporters (13). Blast analysis comparing the amino acid sequence of PmSUC2 to that of Mal61p indicates that these transporters do not share significant sequence homology (only 10% identity largely in transmembrane domains). When expressed in Saccharomyces, PmSUC2 was found to be capable of transporting sucrose and this sucrose transport was inhibited by maltose, indicating that PmSUC2 could also be capable of transporting maltose (13). Plasmid pPTE18, which carries the PmSUC2 gene under the control of the constitutive Saccharomyces PMA1 promoter, was introduced into maltose permease deletion strain CMY1050, and the ability to support maltose induction was tested. As shown in Table 2, growth in glycerol-lactate allows expression of PmSUC2 and produces a low but significant level of maltose transport activity. The maltose transport rate in cells expressing PMA1promoter-PmSUC2 is approximately 10-fold lower than that in cells carrying ADH1-MAL61, but this reduced transport rate is nevertheless sufficient to cause wild-type levels of maltase induction. CMY1050 carrying constitutively expressed ADH1promoter-MAL61 is presented as a control.

To test whether PmSUC2-mediated induction is dependent on the MAL-activator, MAL13 was deleted from CMY1050, creating CMY1061 (mal61{Delta} mal13{Delta}) and maltose induction of maltase was assayed in transformants constitutively expressing either Mal61p or PmSUC2. The results in Table 2 demonstrate that loss of the MAL13 activator gene blocks maltose-induced maltase expression by both the PmSUC2 transporter and Mal61/HA permease. Thus, PmSUC2-dependent maltose induction requires the MAL-activator. Taken together, theses results indicate that intracellular maltose is sufficient to induce MAL gene expression independently of the mechanism of maltose transport and that induction by intracellular maltose is dependent on the MAL-activator.

The concentration of intracellular maltose correlates with the level of the induction. Medintz et al. (24) constructed a series of deletions of the N-terminal cytoplasmic domain of Mal61/HA permease as part of a study done to localize the target site of glucose-induced endocytosis and proteolysis. One interesting mutation, a deletion of residues 61 to 90, exhibited little or no transport activity but nonetheless was able to induce MAL gene expression. Further analysis of this mutant is shown in Table 3. The maltose transport activity of strains expressing mal61/HA({Delta}61-90) from the native promoter, when measured at a substrate concentration of 1 mM maltose (standard assay condition), does not differ significantly from that of the vector control. Measurement of Vmax by Lineweaver-Burk analysis found an approximately threefold increase in Vmax compared to that of the vector control, and this suggests that the low level of maltose induction exhibited by this strain could be a function of this very low rate of maltose transport (Table 3). The Km of the Mal61/HA({Delta}61-90) permease is unaffected (approximately 1.1 mM for both alleles). Expression of mal61/HA({Delta}61-90) from the constitutive ADH1 promoter allowed a modest increase in maltose transport activity and a slight increase in maltase induction levels. These activities were still too low to allow rapid maltose fermentation. As a result, the strain grows slowly on maltose as the sole carbon source and growth is not associated with carbon dioxide bubble formation.


View this table:
[in this window]
[in a new window]
 
TABLE 3. Maltose induction of MAL gene expression in strains carrying MAL61/HA({Delta}61-90)a

 
An additional series of MAL61/HA mutants containing deletions of the C-terminal cytoplasmic domain were constructed by creation of a translation stop site at codon 560, 570, 575, or 581 and by removal of codons 571 to 580 as described in Materials and Methods. Plasmid-borne copies of these mutant alleles were transformed into strain CMY1050, and the transformants were tested for the ability to induce maltase activity. The results are shown in Table 4. Also shown are the levels of maltose transport activity and permease protein expressed by the transformants. A clear correlation can be observed between the levels of maltose transport activity and maltase induction. Additionally, residues 571 to 580 appear to play an important role in maltose transport activity but not an essential role in induction. Truncation of Mal61p to residue 580 has only a modest effect on transport activity, while truncation to residue 574 or 559 or deletion of residues 571 to 580 severely reduces or eliminates transport (Table 4). Deletion of residues 571 to 580 reduces transport activity almost 20-fold, but maltase induction is reduced to about one-third of the wild-type level (Table 4). The results reported in Tables 3 and 4 suggest that extremely low levels of intracellular maltose are able to trigger MAL gene induction and that, at these limiting intracellular maltose concentrations, the level of induction correlates with the presumed level of intracellular maltose.


View this table:
[in this window]
[in a new window]
 
TABLE 4. Maltose induction of MAL gene expression in strains carrying mutations in the C-terminal cytoplasmic domain of Mal61/HA maltose permeasea

 
Low rates of maltose transport activity cause a delay in induction by very low extracellular concentrations of maltose. The finding that, at very low levels of maltose transport activity, induction correlates with transport rates suggests that the threshold level of intracellular maltose needed to induce the MAL genes is very low. If a strain expressing mal61/HA({Delta}61-90) from its native promoter were grown in medium containing a very low concentration of maltose, we would expect a delay in induction because greater time would be needed to accumulate sufficient intracellular maltose to reach this threshold level. We wished to test this prediction. Strains expressing either mal61/HA({Delta}61-90) or MAL61/HA were grown to early log phase under uninduced conditions and transferred to medium containing either 0.5 or 0.01% maltose. The time courses of maltase induction at these two concentrations are compared in Fig. 1. When transferred to medium containing 0.5% maltose, the strain expressing wild-type maltose permease initiates induction at approximately 30 min while induction is delayed to about 1 to 1.5 h in the strain expressing mutant permease. Moreover, the rate of increase in maltase activity is far more rapid in cells expressing wild-type permease. In contrast, when the time course of induction is followed in medium containing 0.01% maltose, induction in the wild-type strain still initiates at about 30 min, although the rate of increase in maltase activity is slowed, but no significant induction is observed in the strain expressing mutant maltose permease, even after 4 h. These results are consistent with the proposal that a threshold level of intracellular maltose is needed in order to trigger MAL gene induction and that this threshold level is rather low.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 1. Time course of maltase induction in strains expressing either MAL61/HA or mal61/HA({Delta}61-90) maltose permease. CMY1050 strains expressing either mal61/HA({Delta}61-90) or MAL61/HA were grown to early log phase under uninduced conditions (3% glycerol and 2% lactate) and transferred to inducing medium containing 3% glycerol-2% lactate plus either 0.5% (13.9 mM) (A) or 0.01% (0.3 mM) (B) maltose. Cells were collected at the indicated time points, and maltase activity was assayed as described in Materials and Methods. The data represent the averages and standard deviations of results obtained in at least two independent assays for cultures grown under both conditions.

 
Overexpression of Mal61 maltose permease rescues the defect in MAL induction caused by the mal13, but not the mal33, mutant activator. Strain YPH500, which is essentially isogenic to S288C, contains two MAL loci mapping to the right telomeres of chromosomes VII (MAL1) and II (MAL3) but is unable to ferment maltose and is defective for maltose induction (Table 5, line 3). This induction defect is complemented by a plasmid-borne copy of MAL63 encoding the MAL-activator from MAL6 (Table 5, line 1), indicating that the noninducible phenotype of YPH500 results from a lack of a functional MAL activator. The amino acid sequences of the defective mal13p and mal33p MAL activators encoded by YPH500 are 70.7 and 71.2% identical to Mal63p, respectively.


View this table:
[in this window]
[in a new window]
 
TABLE 5. Constitutive MAL61 expression suppresses the defective mal13 MAL activator but not mal33 of strain YPH500a

 
As part of a separate study of the MAL activator, we introduced a plasmid carrying the ADH1promoter-MAL61 gene into YPH500. Much to our surprise, we found that constitutive high-level expression of Mal61 permease is able to restore maltose inducibility of maltase expression to wild-type levels in strain YPH500 despite its defective MAL-activators (Table 5, lines 1, 2, and 4).

To determine whether rescue by ADH1promoter-MAL61/HA is dependent on mal13, mal33, or both, single and double deletions of both genes were constructed in strain YPH500, yielding CMY1071, CMY1072, and CMY1073, and maltose induction of maltase was assayed. Loss of mal13 blocked the suppressing effect of constitutive Mal61 permease (Table 5, lines 6 and 10). The strain lacking only mal33 was still rescued by overexpressed Mal61 permease, as well as strain YPH500 (Table 5, line 8). These results indicate that constitutive, high-level Mal61 permease expression rescues the induction defect caused by mal13 but not that caused by mal33.

Rescue of the defective mal13 MAL-activator is not specifically dependent on Mal61 maltose permease. The results shown in Table 5 may be interpreted in two ways. First, if the maltose permease protein itself were to play a direct role in induction, simple restoration of maltose transport activity by an unrelated transport protein such as PmSUC2 permease should not be able to rescue the defective mal13 MAL-activator. An example of such is the direct binding of the Escherichia coli MalT transcription activator to the maltose transport complex (MalEFGK2) (29). Alternatively, if rapid delivery of an initially very high concentration of intracellular maltose were capable of triggering MAL gene induction by the defective mal13 MAL-activator, different permeases with varied transport activities should vary in the ability to rescue mal13. Thus, even the PmSUC2-encoded transporter should be capable of rescuing mal13 despite its lack of sequence homology to Mal61 permease. To test this, plasmids constitutively expressing different versions of maltose permease genes [MAL61/HA, mal61/HA({Delta}61-90), and PmSUC2] were introduced into YPH500 and maltase induction was assayed. The results in Table 6 indicate that PmSUC2 permease is able to rescue the defective mal13 MAL-activator. Moreover, the significantly reduced level of maltose transport by PmSUC2 has a relatively modest impact on mal13 suppression, suggesting that the suppression is solely a function of the maltose transport activity of PmSUC2 permease and is unrelated to any specific sequence feature of this protein.


View this table:
[in this window]
[in a new window]
 
TABLE 6. Constitutive PmSUC2 suppresses the defective MAL activator genes of strain YPH500a

 

    DISCUSSION
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Intracellular maltose is sufficient to induce MAL gene expression. We provide several lines of evidence demonstrating that intracellular maltose is sufficient to induce MAL gene expression in Saccharomyces. PmSUC2, a sucrose transporter from P. major, was used as a surrogate for the Saccharomyces maltose permease to transport maltose into a strain lacking the native maltose permease. Blast analysis shows that PmSUC2 has no significant sequence homology to the Mal61 and Agt1 maltose permeases. Sequence identity among these transporters is about 10% and is largely confined to the transmembrane domains. Given the lack of significant sequence homology, we feel confident in concluding that PmSUC2 is only functioning as a maltose transporter in our Saccharomyces strains. The finding that PmSUC2 is able to replace the Saccharomyces maltose permease therefore provides strong evidence that accumulation of intracellular maltose concentrations is sufficient to stimulate MAL gene induction. Our results do not exclude the possibility that the true inducer is a metabolite of maltose and not maltose itself, but we believe this to be unlikely.

The level of intracellular maltose required to initiate induction and to maintain the induced state appears to be quite low. Strains expressing defective maltose permeases exhibit a significant reduction in their maximal induced levels of maltase activity (Tables 3 and 4), and induction correlates well with the reduced rate of maltose transport capacity of these strains. Moreover, very low levels of maltose transport cause a delay in maltase induction when extracellular maltose concentrations are limiting. Both findings suggest that accumulation of intracellular maltose to a threshold level is needed to initiate the induction and that the threshold level is rather low.

Maltose permease does not appear to function as a maltose sensor. Demonstrating that intracellular maltose is sufficient to stimulate MAL gene induction does not exclude the possibility that the Saccharomyces maltose permease also has a sensor-like role in induction. Our finding that constitutive high-level expression of Mal61 maltose permease suppresses the defective mal13-encoded MAL-activator suggested a possible role in induction for maltose permease similar to that of the E. coli maltose transport complex in the bacterial maltose utilization system. In the E. coli maltose-maltodextrin system, uptake is mediated by a periplasmic binding protein-dependent ABC transporter (the MalEFGK2 complex). MalT, a transcriptional activator, is sequestered at the plasma membrane in the inactive monomeric form by binding to the idling transporter complex via MalK. Transport of maltose by the transporter complex releases MalT from MalK-MalT interaction, enabling it to form active oligomeric MalT in the presence of the effectors ATP and maltotriose (3).

One possible mechanism by which constitutive Mal61 permease expression could suppress the defective mal13 gene is specific binding of the activator. Under uninduced growth conditions, the permease might sequester the MAL-activator at the plasma membrane and thereby prevent the MAL-activator from entering the nucleus and activating MAL gene transcription. Conformational changes in maltose permease induced by maltose transport might destabilize the putative interaction between maltose permease and the MAL-activator, resulting in MAL-activator release, nuclear entry, and MAL gene activation. Binding of the defective mal13 activator to the constitutive elevated levels of maltose permease might protect it from degradation or other forms of inactivation, thereby suppressing this mutant form of the activator.

Our finding that constitutive expression of PmSUC2 also suppresses the defective mal13 MAL-activator argues against the specific-binding model and supports a second model. In this model, the large bolus of maltose transported into the cell via the abundant maltose permease suppresses the defect of mal13p, suggesting that the defect of the mutant activator protein is in its ability to respond to the maltose signal.

On the basis of these results, we propose that maltose permease serves solely as a maltose transporter. It accumulates intracellular concentrations of maltose to levels sufficient to both induce MAL gene expression and provide an energy source for growth. In cells grown under uninduced conditions, the basal low level of maltose permease expression is sufficient to transport enough maltose into the cell to allow the accumulation of intracellular maltose to levels that are adequate to promote the activation of the MAL activator and induce further structural gene expression. Wykoff and O'Shea (37) similarly concluded that the phosphate transporter Pho84p, which is essential during phosphate starvation, does not serve as the phosphate sensor and suggested that the intracellular phosphate concentration regulates PHO gene expression.

So, what is the maltose sensor? One likely possibility is that the MAL activator itself binds to maltose directly. In work to be reported elsewhere, we have shown that maltase induction is dependent on the Hsp90 molecular chaperone complex (B. Zhang, M. Bali, K. Morano, and C. A. Michels, unpublished data). Several other transcriptional activators are known to associate with Hsp90 (16). Members of the steroid receptor family of activators are released from the chaperone complex following direct binding of the cognate steroid (31). Similarly, Hap1 activator release from the Hsp90 chaperone complex is dependent on heme binding (14, 40). An alternate possibility is that a Gal3-like protein serves as the maltose sensor. We do not favor this hypothesis because, despite extensive genetic analysis, specific maltose-nonfermenting mutants with mutations in genes unlinked to the MAL loci have not been isolated. Currently, we are using genetic approaches to identify the maltose-binding sensor.


    ACKNOWLEDGMENTS
 
We thank Norbert Sauer of the University of Erlangen, Erlangen, Germany, for generously providing plasmid pPTE18.

This work was supported by grants from the National Institutes of Health (GM28216 and GM49280) to C.A.M.


    FOOTNOTES
 
* Corresponding author. Mailing address: Queens College and Graduate School of CUNY Biology Department, 65-30 Kissena Blvd., Flushing, NY 11367. Phone: (718) 997-3400. Fax: (718) 997-3321. E-mail: Corinne_michels{at}qc.edu. Back

{dagger} Present address: Center for Bio/Molecular Science and Engineering, U.S. Naval Research Laboratory, Washington, DC 20375. Back


    REFERENCES
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Barker, L., C. Kuhn, A. Weise, A. Schulz, C. Gebhardt, B. Hirner, H. Hellmann, W. Schulze, J. M. Ward, and W. B. Frommer. 2000. SUT2, a putative sucrose sensor in sieve elements. Plant Cell 12:1153-1164.[Abstract/Free Full Text]
  2. Benito, B., and R. Lagunas. 1992. The low-affinity component of Saccharomyces cerevisiae maltose transport is an artifact. J. Bacteriol. 174:3065-3069.[Abstract/Free Full Text]
  3. Boos, W., and A. Bohm. 2000. Learning new tricks from an old dog: MalT of the Escherichia coli maltose system is part of a complex regulatory network. Trends Genet. 16:404-409.[CrossRef][Medline]
  4. Carlson, M. 1999. Glucose repression in yeast. Curr. Opin. Microbiol. 2:202-207.[CrossRef][Medline]
  5. Charron, M. J., R. A. Dubin, and C. A. Michels. 1986. Structural and functional analysis of the MAL1 locus of Saccharomyces cerevisiae. Mol. Cell. Biol. 6:3891-3899.[Abstract/Free Full Text]
  6. Charron, M. J., and C. A. Michels. 1988. The naturally occurring alleles of MAL1 in Saccharomyces species evolved by various mutagenic processes including chromosomal rearrangement. Genetics 120:83-93.[Abstract/Free Full Text]
  7. Charron, M. J., E. Read, S. R. Haut, and C. A. Michels. 1989. Molecular evolution of the telomere-associated MAL loci of Saccharomyces. Genetics 122:307-316.[Abstract/Free Full Text]
  8. Cheng, Q., and C. A. Michels. 1989. The maltose permease encoded by the MAL61 gene of Saccharomyces cerevisiae exhibits both sequence and structural homology to other sugar transporters. Genetics 123:477-484.[Abstract/Free Full Text]
  9. Colombo, S., P. Ma, L. Cauwenberg, J. Winderickx, M. Crauwels, A. Teunissen, D. Nauwelaers, J. H. de Winde, M. F. Gorwa, D. Colavizza, and J. M. Thevelein. 1998. Involvement of distinct G-proteins, Gpa2 and Ras, in glucose- and intracellular acidification-induced cAMP signalling in the yeast Saccharomyces cerevisiae. EMBO J. 17:3326-3341.[CrossRef][Medline]
  10. Donzeau, M., and W. Bandlow. 1999. The yeast trimeric guanine nucleotide-binding protein alpha subunit, Gpa2p, controls the meiosis-specific kinase Ime2p activity in response to nutrients. Mol. Cell. Biol. 19:6110-6119.[Abstract/Free Full Text]
  11. Dubin, R. A., R. B. Needleman, D. Gossett, and C. A. Michels. 1985. Identification of the structural gene encoding maltase within the MAL6 locus of Saccharomyces carlsbergensis. J. Bacteriol. 164:605-610.[Abstract/Free Full Text]
  12. Elledge, S. J., and R. W. Davis. 1988. A family of versatile centromeric vectors designed for use in the sectoring-shuffle mutagenesis assay in Saccharomyces cerevisiae. Gene 70:303-312.[CrossRef][Medline]
  13. Gahrtz, M., J. Stolz, and N. Sauer. 1994. A phloem-specific sucrose-H+ symporter from Plantago major L. supports the model of apoplastic phloem loading. Plant J. 6:697-706.[CrossRef][Medline]
  14. Hach, A., T. Hon, and L. Zhang. 2000. The coiled coil dimerization element of the yeast transcriptional activator Hap1, a Gal4 family member, is dispensable for DNA binding but differentially affects transcriptional activation. J. Biol. Chem. 275:248-254.[Abstract/Free Full Text]
  15. Han, E. K., F. Cotty, C. Sottas, H. Jiang, and C. A. Michels. 1995. Characterization of AGT1 encoding a general alpha-glucoside transporter from Saccharomyces. Mol. Microbiol. 17:1093-1107.[CrossRef][Medline]
  16. Helmbrecht, K., E. Zeise, and L. Rensing. 2000. Chaperones in cell cycle regulation and mitogenic signal transduction: a review. Cell Prolif. 33:341-365.[CrossRef][Medline]
  17. Iraqui, I., S. Vissers, F. Bernard, J. O. de Craene, E. Boles, A. Urrestarazu, and B. Andre. 1999. Amino acid signaling in Saccharomyces cerevisiae: a permease-like sensor of external amino acids and F-box protein Grr1p are required for transcriptional induction of the AGP1 gene, which encodes a broad-specificity amino acid permease. Mol. Cell. Biol. 19:989-1001.[Abstract/Free Full Text]
  18. Johnston, M. 1999. Feasting, fasting and fermenting. Glucose sensing in yeast and other cells. Trends Genet. 15:29-33.[CrossRef][Medline]
  19. Kraakman, L., K. Lemaire, P. Ma, A. W. Teunissen, M. C. Donaton, P. Van Dijck, J. Winderickx, J. H. de Winde, and J. M. Thevelein. 1999. A Saccharomyces cerevisiae G-protein coupled receptor, Gpr1, is specifically required for glucose activation of the cAMP pathway during the transition to growth on glucose. Mol. Microbiol. 32:1002-1012.[CrossRef][Medline]
  20. Lorenz, M. C., and J. Heitman. 1998. The MEP2 ammonium permease regulates pseudohyphal differentiation in Saccharomyces cerevisiae. EMBO J. 17:1236-1247.[CrossRef][Medline]
  21. Lorenz, M. C., X. Pan, T. Harashima, M. E. Cardenas, Y. Xue, J. P. Hirsch, and J. Heitman. 2000. The G protein-coupled receptor Gpr1 is a nutrient sensor that regulates pseudohyphal differentiation in Saccharomyces cerevisiae. Genetics 154:609-622.[Abstract/Free Full Text]
  22. Madi, L., S. A. McBride, L. A. Bailey, and D. J. Ebbole. 1997. rco-3, a gene involved in glucose transport and conidiation in Neurospora crassa. Genetics 146:499-508.[Abstract]
  23. Medintz, I., H. Jiang, E. K. Han, W. Cui, and C. A. Michels. 1996. Characterization of the glucose-induced inactivation of maltose permease in Saccharomyces cerevisiae. J. Bacteriol. 178:2245-2254.[Abstract/Free Full Text]
  24. Medintz, I., H. Jiang, and C. A. Michels. 1998. The role of ubiquitin conjugation in glucose-induced proteolysis of Saccharomyces maltose permease. J. Biol. Chem. 273:34454-34462.[Abstract/Free Full Text]
  25. Medintz, I., X. Wang, T. Hradek, and C. A. Michels. 2000. A PEST-like sequence in the N-terminal cytoplasmic domain of Saccharomyces maltose permease is required for glucose-induced proteolysis and rapid inactivation of transport activity. Biochemistry 39:4518-4526.[CrossRef][Medline]
  26. Michels, C. A., E. Read, K. Nat, and M. J. Charron. 1992. The telomere-associated MAL3 locus of Saccharomyces is a tandem array of repeated genes. Yeast 8:655-665.[CrossRef][Medline]
  27. Naumov, G. I., E. S. Naumova, and C. A. Michels. 1994. Genetic variation of the repeated MAL loci in natural populations of Saccharomyces cerevisiae and Saccharomyces paradoxus. Genetics 136:803-812.[Abstract]
  28. Nehls, U., J. Wiese, M. Guttenberger, and R. Hampp. 1998. Carbon allocation in ectomycorrhizas: identification and expression analysis of an Amanita muscaria monosaccharide transporter. Mol. Plant-Microbe Interact. 11:167-176.[Medline]
  29. Panagiotidis, C. H., W. Boos, and H. A. Shuman. 1998. The ATP-binding cassette subunit of the maltose transporter MalK antagonizes MalT, the activator of the Escherichia coli mal regulon. Mol. Microbiol. 30:535-546.[CrossRef][Medline]
  30. Peng, G., and J. E. Hopper. 2000. Evidence for Gal3p's cytoplasmic location and Gal80p's dual cytoplasmic-nuclear location implicates new mechanisms for controlling Gal4p activity in Saccharomyces cerevisiae. Mol. Cell. Biol. 20:5140-5148.[Abstract/Free Full Text]
  31. Richter, K., and J. Buchner. 2001. Hsp90: chaperoning signal transduction. J. Cell. Physiol. 188:281-290.[CrossRef][Medline]
  32. Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122:19-27.[Abstract/Free Full Text]
  33. Sil, A. K., S. Alam, P. Xin, L. Ma, M. Morgan, C. M. Lebo, M. P. Woods, and J. E. Hopper. 1999. The Gal3p-Gal80p-Gal4p transcription switch of yeast: Gal3p destabilizes the Gal80p-Gal4p complex in response to galactose and ATP. Mol. Cell. Biol. 19:7828-7840.[Abstract/Free Full Text]
  34. Van Belle, D., and B. Andre. 2001. A genomic view of yeast membrane transporters. Curr. Opin. Cell Biol. 13:389-398.[CrossRef][Medline]
  35. Wach, A., A. Brachat, R. Pohlmann, and P. Philippsen. 1994. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10:1793-1808.[CrossRef][Medline]
  36. Welton, R. M., and C. S. Hoffman. 2000. Glucose monitoring in fission yeast via the Gpa2 G{alpha}, the git5 Gß and the git3 putative glucose receptor. Genetics 156:513-521.[Abstract/Free Full Text]
  37. Wykoff, D. D., and E. K. O'Shea. 2001. Phosphate transport and sensing in Saccharomyces cerevisiae. Genetics 159:1491-1499.[Abstract/Free Full Text]
  38. Xue, Y., M. Batlle, and J. P. Hirsch. 1998. GPR1 encodes a putative G protein-coupled receptor that associates with the Gpa2p G{alpha} subunit and functions in a Ras-independent pathway. EMBO J. 17:1996-2007.[CrossRef][Medline]
  39. Yun, C. W., H. Tamaki, R. Nakayama, K. Yamamoto, and H. Kumagai. 1998. Gpr1p, a putative G-protein coupled receptor, regulates glucose-dependent cellular cAMP level in yeast Saccharomyces cerevisiae. Biochem. Biophys. Res. Commun. 252:29-33.[CrossRef][Medline]
  40. Zhang, L., A. Hach, and C. Wang. 1998. Molecular mechanism governing heme signaling in yeast: a higher-order complex mediates heme regulation of the transcriptional activator HAP1. Mol. Cell. Biol. 18:3819-3828.[Abstract/Free Full Text]


Eukaryotic Cell, October 2002, p. 696-703, Vol. 1, No. 5
1535-9778/02/$04.00+0     DOI: 10.1128/EC.1.5.696-703.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, X.
Right arrow Articles by Michels, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, X.
Right arrow Articles by Michels, C. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Appl. Environ. Microbiol. Infect. Immun. J. Bacteriol.
Mol. Cell Biol. Microbiol. Mol. Biol. Rev. ALL ASM JOURNALS