This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Monteoliva, L.
Right arrow Articles by Pla, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Monteoliva, L.
Right arrow Articles by Pla, J.

 Previous Article  |  Next Article 

Eukaryotic Cell, August 2002, p. 514-525, Vol. 1, No. 4
1535-9778/02/$04.00+0     DOI: 10.1128/EC.1.4.514-525.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.

Large-Scale Identification of Putative Exported Proteins in Candida albicans by Genetic Selection

L. Monteoliva,1 M. López Matas,1,{dagger} C. Gil,1 C. Nombela,1 and J. Pla1*

Departamento de Microbiología II, Facultad de Farmacia, Universidad Complutense de Madrid, E-28040 Madrid, Spain

Received 29 January 2002/ Accepted 29 April 2002


arrow
ABSTRACT
 
In all living organisms, secreted proteins play essential roles in different processes. Of special interest is the construction of the fungal cell wall, since this structure is absent from mammalian cells. The identification of the proteins involved in its biogenesis is therefore a primary goal in antifungal research. To perform a systematic identification of such proteins in Candida albicans, we carried out a genetic screening in which in-frame fusions with an intracellular allele of invertase gene SUC2 of Saccharomyces cerevisiae can be used to select and identify putatively exported proteins in the heterologous host S. cerevisiae. Eighty-three clones were selected, including 11 previously identified genes from C. albicans as well as 41 C. albicans genes that encode proteins homologous to already described proteins from related organisms. They include enzymes involved in cell wall synthesis and protein secretion. We also found membrane receptors and transporters presumably related to the interaction of C. albicans with the environment as well as extracellular enzymes and proteins involved in different morphological transitions. In addition, 11 C. albicans open reading frames (ORFs) identified in this screening encode proteins homologous to unknown or putative proteins, while 5 ORFs encode novel secreted proteins without known homologues in other organisms. This screening procedure therefore not only identifies a set of targets of interest in antifungal research but also provides new clues for understanding the topological locations of many proteins involved in processes relevant to the pathogenicity of this microorganism.


arrow
INTRODUCTION
 
Fungal infections are currently an important source of morbidity and mortality in several countries. Fungi cause a range of diseases, ranging from relatively moderate superficial infections to severe systemic diseases that are often life threatening. Their treatment is difficult because of the close similarity between mammalian and microbial cells and is mainly based on polyenes and azoles (6). Polyenes have several side effects which can be partially overcome with the introduction of new liposome-based formulations. In contrast, emerging resistance to azoles may seriously compromise their usefulness in the near future (67, 85). All the foregoing aspects have prompted the development of new strategies for the search for novel antifungal targets. Because of its absence in mammalian cells, the fungal cell wall, like that of bacteria, is the most attractive multienzymatic target, conferring potential selectivity to antimicrobial agents through its inhibition (21). The cell wall is a highly dynamic structure that is composed mainly of glucan (ß-1,3 and ß-1,6 type), chitin, and cell wall mannoproteins. These components are essential to fungal cells either as cross-linking enzymes that covalently join different proteins to the ß-1,3, ß-1,6, or chitin fractions of the wall or as structural components. They are also involved in morphogenesis and may regulate the exchange of compounds with the extracellular medium. In pathogenic fungi, cell wall proteins play a key role in the relationship between the fungal cell and the host, participating in pathogenesis through adhesion phenomena and modulation of the immune response (15).

The cell wall is not the only important source of potential targets, and other exported proteins can be also considered in this context. Membrane proteins, for example, play an essential role in fungal physiology because they are involved in nutrient transport, energy generation, and signal transduction pathways, ultimately leading to growth and host adaptation. Extracellular enzymes encode hydrolytic enzymes, such as lipases (47, 81), proteases (36, 37), and cell wall-hydrolyzing enzymes (32, 50), that are involved in pathogenicity and virulence, mainly through their contribution to invasion. The identification of these secreted proteins is thus of enormous interest because their inhibition may ultimately lead to cellular death, either as a direct consequence of cellular processes—such as the inhibition of cell wall assembly—or because they are novel virulence factors whose inhibition enables the host immune response to control and eradicate infection.

The identification of exported proteins has remained elusive for several reasons. Biochemical separation of cell wall proteins is complicated by their high level of glycosylation and cross-linking to other cell wall components (17, 43). Genetic methods are therefore an alternative approach to analyzing the localizations of these proteins. Although there are no intrinsic specific domains characteristic of exported proteins, most of them have a signal peptide: a 10- to 30-amino-acid-long amino-terminal domain that has a characteristic hydrophobicity profile, that is cleaved off during secretion, and that is responsible for introducing the protein into the secretory pathway (18, 78). Although its existence is neither necessary nor sufficient to unambiguously determine whether a given protein will be present at the cell surface, it can be used as an attractive topological signal to devise genetic screenings with gene reporters and/or gene tags whose localizations can be efficiently traced inside the cell (66).

In this work, we undertook a genetic approach to the identification of exported proteins in Candida albicans; the most frequently isolated fungal pathogen in clinical samples. We made use of genetic selection based on the Saccharomyces cerevisiae invertase gene, SUC2, by means of a strategy in which in-frame fusions with an intracellular allele of this gene can identify putative export signals. This strategy has already proved successful in a mammalian system (45). We thus identified several exported proteins—with several putative new cell wall components—constituting an important source of potential antifungal targets.


arrow
MATERIALS AND METHODS
 
Strains and DNA manipulations. Due to the poor transformation efficiencies obtained with the original S. cerevisiae suc2 mutant strain, SEY2101 (MATa ura3-52 leu2-3,112 ade2-1 suc2-{Delta}9) (27), an Ade+ spontaneous revertant, named SS10, was obtained from this strain. C. albicans 1001 is a wild-type strain from the Spanish Type Culture Collection (ATCC 64385) (30) and was used as the source of genomic DNA for the preparation of the genomic libraries. C. albicans SC5314 is a wild-type strain (31) frequently used in C. albicans genetic studies. All DNA manipulations were carried out by standard procedures (2, 72). Escherichia coli DH5{alpha} [K-12 {Delta}(lacZYA-argF)U169 supE44 thi-1 recA1 endA1 hsdR17 gyrA relA1 (ø80lacZ{Delta}M15) F'] (33) was used in all molecular biology procedures. DNA-modifying enzymes were obtained from Boehringer Mannheim (Mannheim, Germany).

Genetic constructions. Three different suc2 alleles lacking the signal peptide and Met21 (suc2mic1, suc2mic2, and suc2mic3) were constructed by PCR amplification of the SUC2 gene in order to achieve in-frame fusions with fragments obtained from the genomic DNA. The three alleles were amplified by using an Expand High-Fidelity PCR system from Boehringer Mannheim and pLC1 (a centromeric plasmid [obtained from P. Sanz] that comprises the wild-type SUC2 gene) (23) as a template. Three pairs of oligonucleotides were used: SUC2lo (5'-AAGAATTCCTGTTACAGATAGCTTGG-3') and SUC2up1 (5'-AAGAATTCAGATCTCGCGACAAACGAAACTAGCG-3') for suc2mic1 amplification, SUC2lo and SUC2up2 (5'-AAGAATTCAGATCTCGCGACAAACGAAACTAGCG-3') for suc2mic2 amplification, and SUC2lo and SUC2up3 (5'-ATAGATCTCCCGGGACAAACGAAACTAGC-3') to obtain suc2mic3. A BglII restriction site was introduced within the oligonucleotides at the 5' end to allow the construction of in-frame fusions in all three reading frames with Sau3A-derived fragments (Fig. 1A). After PCR amplification, suc2mic1 was rendered blunt ended with the Klenow fragment of DNA polymerase and inserted into the SmaI site of the E. coli-yeast shuttle vector YEp352 (34) to generate pSE1. The SacI-HindIII fragment of pSE1, which carries suc2mic1, was subcloned into the SacI-HindIII sites of YCplac33B (a centromeric yeast vector obtained as a YCplac33 [29] derivative from which the BglII site had been removed) to construct pSC1. Amplified suc2mic2 and suc2mic3 alleles were first subcloned into vector pGEM-T (Promega), excised as SacI-SacI or EcoRI-PstI fragments, and finally inserted into SacI- or EcoRI-PstI-opened YEp352 in order to generate pSE2 and pSE3, respectively. The SacI-SacI fragment carrying suc2mic2 was also subcloned into the SacI site of YCplac33B to obtain pSC2.



View larger version (49K):
[in this window]
[in a new window]
 
FIG. 1. Genetic constructions and testing of the system. (A) Schematic representation of the S. cerevisiae SUC2 gene and the suc2 intracellular alleles constructed. The cleavage site of the signal sequence is indicated by a vertical arrow. Sequence details of the fusion zone are given in the box. The names of the centromeric (pSC series) or episomal (pSE series) versions of the gene library vectors carrying the three different alleles are given. aa, amino acids. (B) Complementation of the Suc2- phenotype with the library vectors and genetic constructions including the SUC2 promoter and signal sequence. (C) Analysis of the functionality of the C. albicans HEX1 promoter and signal sequence.

The primers sucpup (GGCGAGCTCATTTTATCATGTTTCGTTTGT) and sucplo [CGAGGATCC(A/G)(C/T)TGATGCAGATATTTTGGGC] were designed and used for the amplification of a DNA fragment carrying the S. cerevisiae SUC2 promoter and signal sequence from plasmid pLC1. The PCR fragment was cloned into vector pT7Blue-T (Novagen) to make pT7psuc. sucplo had been designed in order to obtain a set of fragments encoding different amino acids at position 21 (Met in SUC2), although sequencing eventually revealed that the fragment in pT7psuc encoded Thr21. After the amplified DNA was excised from this plasmid with BamHI-BamHI, it was subcloned into the BglII sites of plasmids pSE1, pSC1, and pSE3, resulting in pSE1psuc, pSC1psuc, pSC1psuci, pSE3psuc, and pSE3psuci. A DNA fragment containing the promoter, the signal sequence, and the coding sequence up to amino acid 37 of the HEX1 gene from C. albicans was amplified from SC5314 genomic DNA with the primers up-hex1 (ACCCAAGCTTCTATATTGACAGTAAAAGCGTTT) and lo-hex1 (GAGCTCGAGGATCCTTTCCCAGGTTACTGACTAT). After the PCR product was cloned into vector pT7Blue-T, it was excised as a BamHI-BamHI fragment and inserted into the BglII sites of pSC2 and pSE2 to produce plasmids pSE2phex, pSE2phexi, and pSC2phex. pSC2phex and pSE2phex bear the HEX1 promoter and signal sequence fused in frame with the suc2mic2 allele, while pSE2phex1 contains the same DNA insert cloned in the opposite orientation.

For assessing the functionality of these constructs (Fig. 1B), 104 cells of S. cerevisiae SS10 transformants carrying various plasmids were spotted onto YEP-sucrose solid medium (1% yeast extract, 2% peptone, 2% sucrose, 2% agar, 1 µg of antimycin A/ml) and grown at 24°C. pSC1psuc, pSE1psuc, and pSE3psuc bear the SUC2 promoter and signal sequence fused in frame with the corresponding suc2mic allele, while in pSC1psuci and pSE3psuci the same DNA insert is cloned in the opposite orientation. pLC1 is a centromeric plasmid that contains the SUC2 gene.

Library construction and screening. C. albicans genomic DNA was extracted from strain 1001 grown at 30°C overnight in SD medium (2% glucose, 0.67% yeast nitrogen base without amino acids) supplemented with a mixture of amino acids. Genomic DNA was partially digested with Sau3A by use of appropriate dilutions to obtain a high proportion of 0.5- to 4-kb fragments. After preparative electrophoresis, fragments of 0.5 to 2 kb were eluted with dialysis bags; incorporated into episomal vectors pSE1, pSE2, and pSE3; digested with BglII; and treated with calf intestinal alkaline phosphatase to avoid recircularization. After standardization of the optimal vector DNA/genomic DNA ratio for ligations with each of the three vectors, a series of ligation mixtures were pooled. This procedure afforded three fusion libraries in the three different frames, each of which accounted for more than 95% of the recombinant clones. Totals of 231,000, 192,360, and 128,860 colonies were obtained from the pSE1, pSE2, and pSE3 libraries, respectively. The recombinant clones had an average insert size of 1 to 1.3 kb, as determined with several small-scale preparations of plasmid DNA.

For the screening experiments, SS10 was transformed by electroporation (ElectroCell Manipulator 600; BTX Laboratories) with published protocols (4) and with 186 {Omega} and 1,400 V as optimal experimental conditions. Ura+ transformants were selected on solid SD medium supplemented with amino acids and 1 M sorbitol for osmotic protection. They were then replica plated on YEP-sucrose solid medium, and growth was observed after 3 to 10 days at 28°C. Plasmids were recovered from yeast colonies (65) and amplified in E. coli by electroporation (24). All other yeast transformations were carried out by the lithium acetate procedure (40).

Sequencing and in silicio analyses. Inserts of the clones selected were sequenced at the Automatic DNA Sequencing Unit of the Universidad Complutense de Madrid by using oligonucleotide sucseq (5'-CATTCATCCAGCCCTTGTTG-3'), which hybridizes to the 3'-terminal region of suc2mic alleles. Homology searches were made by using the BLASTx and BLASTn programs (www.ncbi.nlm.nih.gov and www.embl-heidelberg.de/Services) against nonredundant databases or by using the BLASTn program against the C. albicans sequence at the Stanford Genome Technology Center. Sequence data for C. albicans were obtained from the Stanford Genome Technology Center website at www.sequence.stanford.edu/group/candida. The putative C. albicans open reading frames (ORFs) and their homologues were detected within assembly 6 of the C. albicans sequence (www.sequence.stanford.edu/group/candida/download). DNA sequence analysis of signal sequences of translated fusion proteins was performed by using the SignalP World Wide Web server (SignalP V1.1 World Wide Web Prediction Server; www.cbs.dtu.dk/services/SignalP) (59); when the results were not very clear, the iPSORT WWW Service at the Human Genome Center, Institute of Medical Science, University of Tokyo (www.HypothesisCreator.net/iPSORT), was also used. Putative glucosylphosphatidylinositol (GPI) anchors were predicted by the PSORTII (Prediction of Protein Sorting Signals and Localization Sites in Amino Acid Sequences) program at the PSORT World Wide Web server (www.psort.nibb.ac.jp/).


arrow
RESULTS
 
Development of a genetic selection scheme for the identification of heterologous exported proteins. The final goal of the genetic strategy devised was the identification of C. albicans proteins that contain export signals. This was achieved by using the S. cerevisiae invertase encoded by SUC2 as a reporter of protein localization. SUC2 encodes an extracellular invertase able to hydrolyze sucrose into glucose and fructose. It thus enables the utilization by yeast cells of sucrose as a sole carbon source. Targeting of secreted proteins to the secretory pathway occurs via a short amino-terminal sequence known as the signal peptide. Deletion of the native invertase signal peptide (amino acids 1 to 19) prevents secretion and results in accumulation of the enzyme within the cell, impairing its ability to grow in a medium with sucrose or raffinose as the sole carbon source (42). This system is therefore convenient not only because the enzymatic activity of invertase is readily detectable but also because it allows a positive selection scheme. We screened the C. albicans fusion libraries with intracellular suc2 alleles in order to isolate gene fragments able to restore secretion ability to the invertase; these would presumably correspond to normally secreted proteins.

Different intracellular alleles (suc2mic1, suc2mic2, and suc2mic3) were constructed, enabling us to obtain in-frame fusions in the three open reading frames. They start at amino acid 22 and therefore lack the native signal peptide and the two initiator methionines of the SUC2 gene (14) (Fig. 1A). The intracellular alleles were introduced into YEp352 and YCplac33B to obtain the multicopy (pSE1, pSE2, and pSE3) and centromeric (pSC1/pSC2) vector series. Episomal vectors were used for the construction of the genomic libraries. The use of multicopy plasmids facilitates a priori the chance of isolating C. albicans genes poorly expressed in S. cerevisiae in this heterologous screening. The functionality of these constructions was checked by using the native SUC2 promoter and signal peptide in both types of vectors in different frames (suc2mic1-pSE1psuc, suc2mic1-pSC1psuc, and suc2mic3-pSE3psuc). SS10 transformants carrying the SUC2 promoter and signal peptide displayed growth on solid (Fig. 1B) as well as in liquid sucrose-antimycin A medium.

In order to validate this strategy for our heterologous screening, we used the C. albicans HEX1 gene. This gene encodes the secreted hydrolytic enzyme ß-N-acetylglucosaminidase (12). The HEX1 gene was selected because of the presence of a clear signal peptide that includes the first 22 amino acids. Expression of the HEX1 gene in S. cerevisiae cells has been shown to occur at moderate levels, although it is not inducible in response to N-acetylglucosamine, as occurs in C. albicans (12). A chimera comprising the sequence encoding the first 37 amino acids of ß-N-acetylglucosaminidase and the suc2mic2 allele was constructed with centromeric (pSC2) and episomal (pSE2) vectors (generating plasmids pSC2phex and pSE2phex, respectively). pSC2phex showed slight complementation of the Suc- phenotype after 8 days of incubation on sucrose-antimycin A plates, while complementation with the episomal version was faster (Fig. 1C). We observed that insertion of the native SUC2 (plasmids pSC1psuci and pSE3psuci) or C. albicans HEX1 (plasmid pSE2phexi) signal peptides in opposite orientations did not complement the Suc- phenotype. These results indicated that the vectors constructed enabled the functional characterization of signal sequences within C. albicans DNA, even with its own regulatory signals.

Screening. A set of three libraries was constructed with C. albicans strain 1001 as a source of genomic DNA. Genomic DNA was used because the expression of C. albicans genes in S. cerevisiae is not a major drawback (63). This DNA was partially digested with Sau3A, and fragments of 0.5 to 2 kb—presumably corresponding to promoters and partial open reading frames—were selected. After SS10 transformation, a total of about 107,900 transformants obtained with the three episomal libraries were screened. Transformants were first grown on SD plates to a cell density of about 2,000 transformants/plate. After replica plating on sucrose medium and 3 to 10 days of incubation, 571 positives clones were selected (~=0.5%). Plasmids were rescued from the corresponding S. cerevisiae transformants and, after amplification in E. coli, were transformed back into the host suc2 strain. Some of these plasmids were eliminated because they failed in these recomplementation assays. First, we sequenced 189 clones and obtained 143 different inserts (after eliminating some S. cerevisiae SUC2 genes, some very small inserts, and some repeated clones). Analysis of those inserts identified several proteins lacking a signal peptide. For this reason, new recomplementation assays were carried out, and only the 83 clones that showed the best complementation of the Suc- phenotype were selected (they were able to grow from 3 to 7 days of incubation and, more importantly, they showed homogeneous growth) (Fig. 2).



View larger version (40K):
[in this window]
[in a new window]
 
FIG. 2. Analysis of the genetic screening. A scheme of the process used in the screening and statistical analysis of the data generated is shown. Tables I, II, III, and IV correspond to Tables 1, 2, 3, and 4, respectively.

Analysis of screening. Plasmids from the 83 isolated clones (named Cep, for Candida exported protein) included the 5' regions of 83 C. albicans putative genes in frame with suc2mic alleles that encoded different types of proteins (Fig. 2). Eleven of these proteins are already present in public databases (Table 1), while 52 share homology with proteins present in public databases (Tables 2 and 3). These correspond to genes already described (Table 2) as well as to putative ORFs determined by sequencing programs (orphan genes) (Table 3). We also found 5 clones that correspond to novel C. albicans ORFs without homologues in any of the public databases (Table 4) and 15 clones that do not match any C. albicans ORF identified at the Stanford Candida Genome Center (Assembly 6 Contig Index) (Table 5).


View this table:
[in this window]
[in a new window]
 
TABLE 1. C. albicans selected proteins described previously


View this table:
[in this window]
[in a new window]
 
TABLE 2. C. albicans proteins homologous to already known proteins


View this table:
[in this window]
[in a new window]
 
TABLE 3. C. albicans proteins homologous to unknown or putative proteins


View this table:
[in this window]
[in a new window]
 
TABLE 4. New C. albicans proteins without known homologues


View this table:
[in this window]
[in a new window]
 
TABLE 5. N-terminal fragments of new putative C. albicans proteins

(i) Previously identified C. albicans proteins. As shown in Table 1, many of the previously identified proteins are related to cell wall biogenesis and include enzymes involved either in the hydrolysis or biosynthesis of major cell wall components, mainly chitin (Cht1p) and glucan (Xog1p, Gsc1p, and Kre9p), or in the proper glycosylation of cell wall mannoproteins (Mnn9p). In addition, and as expected, most of the isolated clones correspond to exported proteins whose localization is the cell surface. Some of the proteins are localized at the plasma membrane, such as Gsc1p/Fks1p (involved in glucan biosynthesis), while other clones identify enzymes that are secreted into the medium. Examples are the major glucanase in C. albicans cells, Xog1p, or members of families involved in the pathogenic process, such as the secretory lipase or the secretory aspartyl proteinase families (Lip4p, Sap10p, and Plb1p).

It is important to note that a signal peptide was detected in 10 of these 11 proteins. The remaining one (ß-1,3-glucan synthase, Gsc1p) is a cytoplasmic membrane protein with no apparent signal peptide. Interestingly, although the insert isolated in clone Cep74 is short, in silicio analysis of the peptide starting at Met648 revealed that the insert could encode a functional signal peptide.

(ii) Proteins homologous to other proteins in databases. The criterion for the inclusion of genes in this subset was a specific degree of homology determined by the E parameter of the BLAST algorithm. DNA sequences were submitted to the Stanford Candida Genome Center, and putative C. albicans ORFs were identified in the Assembly 6 Contig Index. Among the ORFs identified, we selected those that displayed homology to sequences encoding already described or putative proteins with an E value of less than e-10. These are listed in Table 2 (41 clones) or Table 3 (11 clones), respectively.

Twenty-six of the 41 proteins in Table 2 contain C. albicans peptides reported to be located at the cell surface, either as secreted proteins or as cell wall or plasma membrane components. Some of them are indeed proteins related to cell wall construction and/or to the maintenance of its integrity (i.e., Chr1p, Chr2p, Wsc3p, Wsc2p, PstIp, and Kre1p). Alternatively, they are structural cell wall component proteins (Pir3p). Most of these proteins (24 clones) display a clear signal peptide. An additional group of 13 clones correspond to C. albicans proteins whose homologues are located in the secretory pathway. Some of them are involved in the secretory mechanism that allows other proteins to reach the cell surface. For example, Scj1p, Mpd1p, and Hdr3p are involved in protein folding or are required when unfolded or misfolded proteins are introduced into the endoplasmic reticulum (ER), while Erv25p and Emp24p form a complex constituent of the COPII coat of certain ER-derived vesicles. Some proteins also located in the secretory pathway are involved in the N-glycosylation process of mannoproteins (Ost3p or Swp1p) or in GPI anchor synthesis (Gpi16p).

For 11 of the selected clones, the C. albicans fragment displays homology with novel proteins of unknown function, mainly identified through sequencing projects. These are summarized in Table 3. Interestingly, we cloned a homologue of the S. cerevisiae PRY1 gene—similar to genes encoding plant pathogenesis-related proteins—as well as two clones (Cep211 and Cep91) corresponding to proteins encoded by YAL053w and YGL139w, which are close homologues of each other. Although some of these proteins have been designated putative, it can be assumed that the C. albicans homologue can at least be expressed in this heterologous host.

(iii) New C. albicans proteins without known homologues. Five cloned fusions contain C. albicans gene fragments that encode proteins without homologues in public databases. These proteins, which are completely novel and which, to date, have been detected only in this fungus, are listed in Table 4. In silicio analysis indicated that all of them do have a signal peptide, while ORF 6.701 (Cep79) and ORF 6.7284 (Cep106) encode proteins that seem to be GPI anchored. This result suggested their membrane or cell wall location. Furthermore, ORF 6.7284 encodes a serine- and threonine-rich protein (a feature characteristic of many cell wall proteins). The location of the other three proteins in Table 4 is also predicted to be extracellular.

Table 5 includes 15 clones with a C. albicans sequence that is present at the Stanford Candida Genome Center (Assembly 6 Contig Index) but for which no ORF was identified. For all of them, a peptide encoded by a sequence in frame with the corresponding suc2mic allele was detected, and in some cases a signal peptide was predicted. Further work is needed to determine whether they really encode a functional signal peptide for a C. albicans secreted protein.


arrow
DISCUSSION
 
The availability of the C. albicans genome is having a profound impact on the way in which biological research is being carried out with this fungal pathogen, especially in view of the difficulties involved in C. albicans genetic studies (19, 63). While the amount of information is significant and while several new genes are being identified through global sequencing programs (9,168 ORFs in the Stanford Assembly 6 Contig Index of the C. albicans sequence), there is a significant need to define the functionality of the encoded proteins, especially from the perspective of finding novel cell wall components. Given the ability of several C. albicans genes to be expressed in a heterologous host (63), the complementation of specific S. cerevisiae mutants altered in cell wall functions is an attractive and feasible approach. Global functional strategies have been carried out with S. cerevisiae (for example, using a bacterial ß-galactosidase to monitor both gene expression and subcellular localization) (10, 70); however, for C. albicans, only one recent report, using an antisense approach, has addressed the identification of essential functions (20) in this organism. In the present work, by making use of S. cerevisiae genetic tools, we carried out a genetic screening with the primary goal of identifying C. albicans secretory protein-encoding genes and/or export domains within them. We used the invertase encoded by the SUC2 gene, since this strategy combines both a functional domain identification feature and a positive selection scheme that facilitates subsequent cloning steps. We followed a strategy similar to that already described for the isolation of mammalian exported proteins (45). We thus avoided the use of C. albicans genetic tools, which can be time-consuming.

As expected, we selected a significant number of genes encoding extracellular proteins (39 clones, Tables 1, 2, and 3; Fig. 2 shows localization by description, homology, or in silicio analysis). Some of the proteins have already been shown to be located in the fungal cell wall (eight clones) and to be involved either in the biosynthesis of the major cell wall components glucan and chitin or in the maintenance of this cellular structure. Proteins whose final destination is the cytoplasmic membrane (11 clones) or that are destined for secretion (9 clones) were also identified, since these are apparently able to enter the secretory pathway. They include membrane receptors and transporters and extracellular enzymes. In some cases, the true subcellular location of the identified protein is not well defined, although it is known or predicted to be the cell surface (11 clones). The five new C. albicans proteins described in Table 4 are included in this group. Identification of these proteins, which, to date, have been considered only putative in the C. albicans sequencing project at the Stanford Genome Technology Center, would be one of the more relevant results of the screening. We observed that the putative ORFs encode expressed proteins, at least in S. cerevisiae. The fact that these proteins have no homologues in databases suggests that they are species-specific proteins, indicating their involvement in processes specific to C. albicans biology, such as dimorphism or virulence.

A different but important group of cloned genes encode proteins located in the secretory machinery. This finding was expected, since these proteins have a signal peptide responsible for their entry into the ER and for reaching their final cellular location. The homologues of most of the proteins found are located in the ER. This finding can be explained in terms of the notion that they are isolated as truncated chimeras and are therefore devoid of the four amino acids that contain the ER carboxy-terminal retention signal (HDEL) (62). Finally, the clones in Table 5 did not correspond to any ORF identified at the Stanford Candida Genome Center (Assembly 6 Contig Index). Among the possible explanations are that they arise from mistakes in the Stanford database, that they are ORFs able to encode proteins shorter than 100 amino acids, or even that they are spliced genes.

It should be stressed that the assignment of proteins or functions between even closely related microorganisms is risky. The assignment of homology in Tables 2 and 3 was made based on computer algorithms and, in some cases, the C. albicans protein may not represent the counterpart of the described protein. For example, the best result in the homology search with Cep101 was UTH1. However, the protein showed homology with all members of the SUN family (56). This family has four members with many different cellular functions. Sun4p, one of its members, has been described as a cell wall protein with a clear signal peptide, as was also observed for the protein corresponding to the C. albicans clone identified in this screening (Cep101). Therefore, a complete functional analysis may change this in silicio assignment. In addition, the subcellular location of any given protein may vary from host to host.

There are some limitations to this screening. One is that it relies on heterologous expression, and although C. albicans genes are normally expressed in S. cerevisiae (63), the level and/or pattern of the time dependence of expression of these genes may differ between the organisms, resulting in a lack of complementation. A few modifications to this screening might expand the numbers of putative exported proteins identified. For example, larger genomic fragments could be selected to avoid the cloning of genes for small peptides (such as the clones in Table 5), which would hinder interpretation of the results. The construction of new genomic libraries (in which genomic DNA is digested with different restriction enzymes or even randomly) should allow the cloning of more new genes. Expression libraries could also be used. In this case, the entire protein, with most of the location domains (except for C-terminal domains such as HDEL or the GPI anchor), would be expressed.

Despite these limitations, the screening carried out here is extremely useful for several reasons. First, it allowed the selection of 5 novel interesting ORFs from among more than 9,000 ORFs in the C. albicans genome. Second, it is a broad-range screening; a similar screening for secretory protein-encoding genes of S. cerevisiae based on the functional selection of fusions with a gene reporter (PHO5) was reported several years ago (77). In this case, the authors described the isolation of five unique sequences and the complete SSP120 gene. Significantly, the C. albicans SSP120 homologue was also obtained in our approach. Third, the SUC2 system has afforded new data about the localization of previously known proteins relevant to different physiological processes but whose localization (measured as the ability to export the intracellular invertase) was not known. These include some proteins relevant to the dimorphic transition, such as Ece1p, the sequence of which was cloned by using a cDNA differential screening (7), or phenotypic switching, such as Ops4, a protein differentially expressed in the opaque phase (55). Finally, the screening was able to select proteins that showed no obvious signal peptide in their amino-terminal regions but which were indeed extracellular proteins. The presence of this kind of protein—such as glycolytic enzymes—within the fungal cell wall has remained controversial for some time (26, 75), although it was recently shown that yeast enolase, encoded by the ENO2 gene, can be efficiently incorporated into regions external to the plasma membrane (61).The use of this system for other genetic elements, such as transposons, may provide an additional useful tool for C. albicans genetic studies.


arrow
ACKNOWLEDGMENTS
 
We thank María Fernández for excellent technical assistance, F. Navarro García for help in the experimental design of this project, and the Centro de Secuenciación Automatizada of the Universidad Complutense de Madrid for expert assistance in DNA sequence analysis.

Sequence data for C. albicans was obtained from the Stanford Genome Technology Center website at http://www-sequence.stanford.edu/group/candida.

Sequencing of C. albicans was accomplished with the support of the NIDR and the Burroughs Wellcome Fund. This work was supported by Janssen Cilag S.A. (Madrid, Spain) and Janssen Research Foundation (Beerse, Belgium).


arrow
FOOTNOTES
 
* Corresponding author. Mailing address: Departamento de Microbiología II, Facultad de Farmacia, Universidad Complutense de Madrid, Plaza de Ramón y Cajal s/n, E-28040 Madrid, Spain. Phone: 34 91 3941617. Fax: 34 91 3941745. E-mail: esuspla{at}farm.ucm.es. Back

{dagger} Present address: Centro de Biología Molecular Severo Ochoa, Consejo Superior de Investigaciones Científicas, Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid, Spain. Back


arrow
REFERENCES
 
    1
  1. Ash, J., M. Dominguez, J. J. Bergeron, D. Y. Thomas, and Y. Bourbonnais. 1995. The yeast proprotein convertase encoded by YAP3 is a glycophosphatidylinositol-anchored protein that localizes to the plasma membrane. J. Biol. Chem. 270:20847-20854.[Abstract/Free Full Text]
  2. 2
  3. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1993. Current protocols in molecular biology. Greene Publishing Associates and Wiley Interscience, New York, N.Y.
  4. 3
  5. Bailey, D. A., P. J. F. Feldmann, M. Bovey, N. A. R. Gow, and A. J. P. Brown. 1996. The Candida albicans HYR1 gene, which is activated in response to hyphal development, belongs to a gene family encoding yeast cell wall proteins. J. Bacteriol. 178:5353-5360.[Abstract/Free Full Text]
  6. 4
  7. Becker, D. M., and L. Guarente. 1991. Transformation of yeast by electroporation. Methods Enzymol. 194:182-187.[Medline]
  8. 5
  9. Belden, W. J., and C. Barlowe. 1996. Erv25p, a component of COPII-coated vesicles, forms a complex with Emp24p that is required for efficient endoplasmic reticulum to Golgi transport. J. Biol. Chem. 271:26939-26946.[Abstract/Free Full Text]
  10. 6
  11. Bennett, J. E. 1996. Antimicrobial agents: antifungal agents, p. 1165-1181. In A. G. Gilman, T. W. Rall, A. S. Sies, and P. Taylor (ed.), Goodman and Gilman's the pharmacological basis of therapeutics. Pergamon Press, Inc., Elmsford, N.Y.
  12. 7
  13. Birse, C. E., M. Y. Irwin, W. A. Fonzi, and P. S. Sypherd. 1993. Cloning and characterization of ECE1, a gene expressed in association with cell elongation of the dimorphic pathogen Candida albicans. Infect. Immun. 61:3648-3655.[Abstract/Free Full Text]
  14. 8
  15. Boisrame, A., J. M. Beckerich, and C. Gaillardin. 1996. Sls1p, an endoplasmic reticulum component, is involved in the protein translocation process in the yeast Yarrowia lipolytica. J. Biol. Chem. 271:11668-11675.[Abstract/Free Full Text]
  16. 9
  17. Boone, C., A. Sdicu, M. Laroche, and H. Bussey. 1991. Isolation from Candida albicans of a functional homolog of the Saccharomyces cerevisiae KRE1 gene, which is involved in cell wall beta-glucan synthesis. J. Bacteriol. 173:6859-6864.[Abstract/Free Full Text]
  18. 10
  19. Burns, N., B. Grimwade, P. B. Ross-Macdonald, E. Y. Choi, K. Finberg, G. S. Roeder, and M. Snyder. 1994. Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae. Genes Dev. 8:1087-1105.[Abstract/Free Full Text]
  20. 11
  21. Camougrand, N. M., M. Mouassite, G. M. Velours, and M. G. Guerin. 2000. The "SUN" family: UTH1, an ageing gene, is also involved in the regulation of mitochondria biogenesis in Saccharomyces cerevisiae. Arch. Biochem. Biophys. 375:154-160.[CrossRef][Medline]
  22. 12
  23. Cannon, R. D., K. Niimi, H. F. Jenkinson, and M. G. Shepherd. 1994. Molecular cloning and expression of the Candida albicans beta-N-acetylglucosaminidase (HEX1) gene. J. Bacteriol. 176:2640-2647.[Abstract/Free Full Text]
  24. 13
  25. Capellaro, C., K. Hauser, V. Mrsa, M. Watzele, G. Watzele, C. Gruber, and W. Tanner. 1991. Saccharomyces cerevisiae a-agglutinin and {alpha}-agglutinin: characterization of their molecular interaction. EMBO J. 10:4081-4088.[Medline]
  26. 14
  27. Carlson, M., and D. Botstein. 1982. Two differentially regulated mRNAs with different 5' ends encode secreted with intracellular forms of yeast invertase. Cell 28:145-154.[CrossRef][Medline]
  28. 15
  29. Chaffin, W. L., J. L. Lopez-Ribot, M. Casanova, D. Gozalbo, and J. P. Martinez. 1998. Cell wall and secreted proteins of Candida albicans: identification, function, and expression. Microbiol. Mol. Biol. Rev. 62:130-180.[Abstract/Free Full Text]
  30. 16
  31. Chambers, R. S., M. J. Broughton, R. D. Cannon, A. Carne, G. W. Emerson, and P. A. Sullivan. 1993. An exo-beta-(1,3)-glucanase of Candida albicans: purification of the enzyme and molecular cloning of the gene. J. Gen. Microbiol. 139:325-334.[Abstract/Free Full Text]
  32. 17
  33. Cid, V. J., A. Durán, F. del Rey, M. P. Snyder, C. Nombela, and M. Sánchez. 1995. Molecular basis of cell integrity and morphogenesis in Saccharomyces cerevisiae. Microbiol. Rev. 59:345-386.[Abstract/Free Full Text]
  34. 18
  35. Cleves, A. E., and V. A. Bankaitis. 1992. Secretory pathway function in Saccharomyces cerevisiae. Adv. Microb. Physiol. 33:73-144.[Medline]
  36. 19
  37. De Backer, M. D., P. T. Magee, and J. Pla. 2000. Recent developments in molecular genetics of Candida albicans. Annu. Rev. Microbiol. 54:463-498.[CrossRef][Medline]
  38. 20
  39. De Backer, M. D., B. Nelissen, M. Logghe, J. Viaene, I. Loonen, S. Vandoninck, R. de Hoogt, S. Dewaele, F. A. Simons, P. Verhasselt, G. Vanhoof, R. Contreras, and W. H. Luyten. 2001. An antisense-based functional genomics approach for identification of genes critical for growth of Candida albicans. Nat. Biotechnol. 19:235-241.[CrossRef][Medline]
  40. 21
  41. Debono, M., and R. S. Gordee. 1994. Antibiotics that inhibit fungal cell wall development. Annu. Rev. Microbiol. 48:471-497.[CrossRef][Medline]
  42. 22
  43. Decottignies, A., and A. Goffeau. 1997. Complete inventory of the yeast ABC proteins. Nat. Genet. 15:137-145.[CrossRef][Medline]
  44. 23
  45. del Castillo, A. L., S. A. Nieto, and R. Sentandreu. 1992. Differential expression of the invertase-encoding SUC genes in Saccharomyces cerevisiae. Gene 120:59-65.[CrossRef][Medline]
  46. 24
  47. Dower, W. J., J. F. Miller, and C. W. Ragsdale. 1988. High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res. 16:6127-6143.[Abstract/Free Full Text]
  48. 25
  49. Eck, R., S. Hundt, A. Hartl, E. Roemer, and W. Kunkel. 1999. A multicopper oxidase gene from Candida albicans: cloning, characterization and disruption. Microbiology 145:2415-2422.[Abstract/Free Full Text]
  50. 26
  51. Edwards, S. R., R. Braley, and W. L. Chaffin. 1999. Enolase is present in the cell wall of Saccharomyces cerevisiae. FEMS Microbiol. Lett. 177:211-216.[CrossRef][Medline]
  52. 27
  53. Emr, S. D., R. Schekman, M. C. Flessel, and J. Thorner. 1983. An MF alpha 1-SUC2 (alpha-factor-invertase) gene fusion for study of protein localization and gene expression in yeast. Proc. Natl. Acad. Sci. USA 80:7080-7084.[Abstract/Free Full Text]
  54. 28
  55. Fraering, P., I. Imhof, U. Meyer, J. M. Strub, A. van Dorsselaer, C. Vionnet, and A. Conzelmann. 2001. The GPI transamidase complex of Saccharomyces cerevisiae contains Gaa1p, Gpi8p, and Gpi16p. Mol. Biol. Cell 12:3295-3306.[Abstract/Free Full Text]
  56. 29
  57. Gietz, R. D., and A. Sugino. 1988. New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534.[CrossRef][Medline]
  58. 30
  59. Gil, C., R. Pomés, and C. Nombela. 1988. A complementation analysis by parasexual recombination of Candida albicans morphological mutants. J. Gen. Microbiol. 134:1587-1595.[Abstract/Free Full Text]
  60. 31
  61. Gillum, A. M., E. Y. H. Tsay, and D. R. Kirsch. 1984. Isolation of the Candida albicans gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol. Gen. Genet. 198:179-182.[CrossRef][Medline]
  62. 32
  63. González, M. M., R. Diez-Orejas, G. Molero, A. M. Alvarez, J. Pla, C. Nombela, and M. Sánchez-Pérez. 1997. Phenotypic characterization of a Candida albicans strain deficient in its major exoglucanase. Microbiology 143:3023-3032.[Abstract/Free Full Text]
  64. 33
  65. Hanahan, D. 1988. Techniques for transformation of E. coli, p. 109-135. In D. M. Glover (ed.), DNA cloning. IRL Press, Oxford, England.
  66. 34
  67. Hill, J. E., A. M. Myers, T. J. Koerner, and A. Tzagoloff. 1986. Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2:163-167.[CrossRef][Medline]
  68. 35
  69. Hoover, C. I., M. J. Jantapour, G. Newport, N. Agabian, and S. J. Fisher. 1998. Cloning and regulated expression of the Candida albicans phospholipase B (PLB1) gene. FEMS Microbiol. Lett. 167:163-169.[CrossRef][Medline]
  70. 36
  71. Hube, B. 1999. Candida albicans secreted aspartyl proteases. Curr. Top. Med. Mycol. 7:55-69.
  72. 37
  73. Hube, B. 1999. Possible role of secreted proteinases in Candida albicans infections. Rev. Iberoam. Micol. 15:65-68.
  74. 38
  75. Hube, B., F. Stehr, M. Bossenz, A. Mazur, M. Kretschmar, and W. Schafer. 2000. Secreted lipases of Candida albicans: cloning, characterisation and expression analysis of a new gene family with at least ten members. Arch. Microbiol. 174:362-374.[CrossRef][Medline]
  76. 39
  77. Iida, H., H. Nakamura, T. Ono, M. S. Okumura, and Y. Anraku. 1994. MID1, a novel Saccharomyces cerevisiae gene encoding a plasma membrane protein, is required for Ca2+ influx and mating. Mol. Cell. Biol. 14:8259-8271.[Abstract/Free Full Text]
  78. 40
  79. Ito, H., Y. Fukuda, K. Murata, and A. Kimura. 1983. Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153:163-168.[Abstract/Free Full Text]
  80. 41
  81. Jiang, B., J. Sheraton, A. F. Ram, G. J. Dijkgraaf, F. M. Klis, and H. Bussey. 1996. CWH41 encodes a novel endoplasmic reticulum membrane N-glycoprotein involved in beta 1,6-glucan assembly. J. Bacteriol. 178:1162-1171.[Abstract/Free Full Text]
  82. 42
  83. Kaiser, C. A., and D. Botstein. 1986. Secretion-defective mutations in the signal sequence for Saccharomyces cerevisiae invertase. Mol. Cell. Biol. 6:2382-2391.[Abstract/Free Full Text]
  84. 43
  85. Kapteyn, J. C., E. H. van den, and F. M. Klis. 1999. The contribution of cell wall proteins to the organization of the yeast cell wall. Biochim. Biophys. Acta 1426:373-383.[Medline]
  86. 44
  87. Karaoglu, D., D. J. Kelleher, and R. Gilmore. 1995. Functional characterization of Ost3p. Loss of the 34-kD subunit of the Saccharomyces cerevisiae oligosaccharyltransferase results in biased underglycosylation of acceptor substrates. J. Cell Biol. 130:567-577.[Abstract/Free Full Text]
  88. 45
  89. Klein, R. D., Q. Gu, A. Goddard, and A. Rosenthal. 1996. Selection for genes encoding secreted proteins and receptors. Proc. Natl. Acad. Sci. USA 93:7108-7113.[Abstract/Free Full Text]
  90. 46
  91. Lamarre, C., N. Deslauriers, and Y. Bourbonnais. 2000. Expression cloning of the Candida albicans CSA1 gene encoding a mycelial surface antigen by sorting of Saccharomyces cerevisiae transformants with monoclonal antibody-coated magnetic beads. Mol. Microbiol. 35:444-453.[CrossRef][Medline]
  92. 47
  93. Leidich, S. D., A. S. Ibrahim, Y. Fu, A. Koul, C. Jessup, J. Vitullo, W. Fonzi, F. Mirbod, S. Nakashima, Y. Nozawa, and M. A. Ghannoum. 1998. Cloning and disruption of caPLB1, a phospholipase B gene involved in the pathogenicity of Candida albicans. J. Biol. Chem. 273:26078-26086.[Abstract/Free Full Text]
  94. 48
  95. Lussier, M., A. M. Sdicu, S. Shahinian, and H. Bussey. 1998. The Candida albicans KRE9 gene is required for cell wall beta-1, 6- glucan synthesis and is essential for growth on glucose. Yeast 95:9825-9830.
  96. 49
  97. McCreath, K. J., C. A. Specht, Y. Liu, and P. W. Robbins. 1996. Molecular cloning of a third chitinase gene (CHT1) from Candida albicans. Yeast 12:501-504.[CrossRef][Medline]
  98. 50
  99. McCreath, K. J., C. A. Specht, and P. W. Robbins. 1995. Molecular cloning and characterization of chitinase genes from Candida albicans. Proc. Natl. Acad. Sci. USA 92:2544-2548.[Abstract/Free Full Text]
  100. 51
  101. Mio, T., M. Adachi-Shimizu, Y. Tachibana, H. Tabuchi, S. B. Inoue, T. Yabe, T. Yamada-Okabe, M. Arisawa, T. Watanabe, and H. Yamada-Okabe. 1997. Cloning of the Candida albicans homolog of Saccharomyces cerevisiae GSC1/FKS1 and its involvement in beta-1,3-glucan synthesis. J. Bacteriol. 179:4096-4105.[Abstract/Free Full Text]
  102. 52
  103. Moehle, C. M., R. Tizard, S. K. Lemmon, J. Smart, and E. W. Jones. 1987. Protease B of the lysosome-like vacuole of the yeast Saccharomyces cerevisiae is homologous to the subtilisin family of serine proteases. Mol. Cell. Biol. 7:4390-4399.[Abstract/Free Full Text]
  104. 53
  105. Monod, M., B. Hube, D. Hess, and D. Sanglard. 1998. Differential regulation of SAP8 and SAP9, which encode two new members of the secreted aspartic proteinase family in Candida albicans. Microbiology 144:2731-2737.[Abstract/Free Full Text]
  106. 54
  107. Moreno, M. A., C. Pascual, A. Gibello, S. Ferrer, C. J. Bos, A. J. Debets, and G. Suarez. 1994. Transformation of Aspergillus parasiticus using autonomously replicating plasmids from Aspergillus nidulans. FEMS Microbiol. Lett. 124:35-41.[CrossRef][Medline]
  108. 55
  109. Morrow, B., T. Srikantha, J. Anderson, and D. R. Soll. 1993. Coordinate regulation of two opaque-phase-specific genes during white-opaque switching in Candida albicans. Infect. Immun. 61:1823-1828.[Abstract/Free Full Text]
  110. 56
  111. Mouassite, M., N. Camougrand, E. Schwob, G. Demaison, M. Laclau, and M. Guerin. 2000. The "SUN" family: yeast SUN4/SCW3 is involved in cell septation. Yeast 16:905-919.[CrossRef][Medline]
  112. 57
  113. Mrsa, V., T. Seidl, M. Gentzsch, and W. Tanner. 1997. Specific labelling of cell wall proteins by biotinylation. Identification of four covalently linked O-mannosylated proteins of Saccharomyces cerevisiae. Yeast 13:1145-1154.[CrossRef][Medline]
  114. 58
  115. Mukhtar, M., D. A. Logan, and N. F. Kaufer. 1992. The carboxypeptidase Y-encoding gene from Candida albicans and its transcription during yeast-to-hyphae conversion. Gene 121:173-177.[CrossRef][Medline]
  116. 59
  117. Nielsen, H., J. Engelbrecht, S. Brunak, and G. von Heijne. 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10:1-6.[Abstract/Free Full Text]
  118. 60
  119. Nosaka, K., Y. Kaneko, H. Nishimura, and A. Iwashima. 1989. A possible role for acid phosphatase with thiamin-binding activity encoded by PHO3 in yeast. FEMS Microbiol. Lett. 51:55-59.[Medline]
  120. 61
  121. Pardo, M., L. Monteoliva, J. Pla, M. Sanchez, C. Gil, and C. Nombela. 1999. Two-dimensional analysis of proteins secreted by Saccharomyces cerevisiae regenerating protoplasts: a novel approach to study the cell wall. Yeast 15:459-472.[CrossRef][Medline]
  122. 62
  123. Pelham, H. R. B. 1991. Recycling of proteins between the endoplasmic reticulum and Golgi complex. Curr. Opin. Cell Biol. 3:585-591.[CrossRef][Medline]
  124. 63
  125. Pla, J., C. Gil, L. Monteoliva, F. Navarro-García, M. Sánchez, and C. Nombela. 1996. Understanding Candida albicans at the molecular level. Yeast 12:1677-1702.[CrossRef][Medline]
  126. 64
  127. Plemper, R. K., J. Bordallo, P. M. Deak, C. Taxis, R. Hitt, and D. H. Wolf. 1999. Genetic interactions of Hrd3p and Der3p/Hrd1p with Sec61p suggest a retro-translocation complex mediating protein transport for ER degradation. J. Cell Sci. 112:4123-4134.[Abstract]
  128. 65
  129. Polaina, J., and A. C. Adam. 1991. A fast procedure for yeast DNA purification. Nucleic Acids Res. 19:5443.[Free Full Text]
  130. 66
  131. Ram, A. F., E. H. van den, and F. M. Klis. 1998. Green fluorescent protein-cell wall fusion proteins are covalently incorporated into the cell wall of Saccharomyces cerevisiae. FEMS Microbiol. Lett. 162:249-255.[CrossRef][Medline]
  132. 67
  133. Rex, J. H., M. G. Rinaldi, and M. A. Pfaller. 1995. Resistance of Candida species to fluconazole. Antimicrob. Agents Chemother. 1:1-8.
  134. 68
  135. Rodriguez-Pena, J. M., V. J. Cid, J. Arroyo, and C. Nombela. 2000. A novel family of cell wall-related proteins regulated differently during the yeast life cycle. Mol. Cell. Biol. 20:3245-3255.[Abstract/Free Full Text]
  136. 69
  137. Roemer, T., K. Madden, J. Chang, and M. Snyder. 1996. Selection of axial growth sites in yeast requires Axl2p, a novel plasma membrane glycoprotein. Genes Dev. 10:777-793.[Abstract/Free Full Text]
  138. 70
  139. Ross-Macdonald, P., P. S. Coelho, T. Roemer, S. Agarwal, A. Kumar, R. Jansen, K. H. Cheung, A. Sheehan, D. Symoniatis, L. Umansky, M. Heidtman, F. K. Nelson, H. Iwasaki, K. Hager, M. Gerstein, P. Miller, G. S. Roeder, and M. Snyder. 1999. Large-scale analysis of the yeast genome by transposon tagging and gene disruption. Nature 402:413-418.[CrossRef][Medline]
  140. 71
  141. Roy, A., C. F. Lu, D. L. Marykwas, P. N. Lipke, and J. Kurjan. 1991. The AGA1 product is involved in cell surface attachment of the Saccharomyces cerevisiae cell adhesion glycoprotein a-agglutinin. Mol. Cell. Biol. 11:4196-4206.[Abstract/Free Full Text]
  142. 72
  143. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  144. 73
  145. Schimmoller, F., B. Singer-Kruger, S. Schroder, U. Kruger, C. Barlowe, and H. Riezman. 1995. The absence of Emp24p, a component of ER-derived COPII-coated vesicles, causes a defect in transport of selected proteins to the Golgi. EMBO J. 14:1329-1339.[Medline]
  146. 74
  147. Schlenstedt, G., S. Harris, B. Risse, R. Lill, and P. A. Silver. 1995. A yeast DnaJ homologue, Scj1p, can function in the endoplasmic reticulum with BiP/Kar2p via a conserved domain that specifies interactions with Hsp70s. J. Cell Biol. 129:979-988.[Abstract/Free Full Text]
  148. 75
  149. Sentandreu, M., M. V. Elorza, E. Valentin, R. Sentandreu, and D. Gozalbo. 1995. Cloning of cDNAs coding for Candida albicans cell surface proteins. J. Med. Vet. Mycol. 33:105-111.[Medline]
  150. 76
  151. Shen, X., A. M. Belcher, P. K. Hansma, G. D. Stucky, and D. E. Morse. 1997. Molecular cloning and characterization of lustrin A, a matrix protein from shell and pearl nacre of Haliotis rufescens. J. Biol. Chem. 272:32472-32481.[Abstract/Free Full Text]
  152. 77
  153. Sidhu, R. S., S. Mathewes, and A. P. Bollon. 1991. Selection of secretory protein-encoding genes by fusion with PHO5 in Saccharomyces cerevisiae. Gene 107:111-118.[CrossRef][Medline]
  154. 78
  155. Sipos, L., and G. von Heijne. 1993. Predicting the topology of eukaryotic membrane proteins. Eur. J. Biochem. 213:1333-1340.[Medline]
  156. 79
  157. Southard, S. B., C. A. Specht, C. Mishra, J. Chen-Weiner, and P. W. Robbins. 1999. Molecular analysis of the Candida albicans homolog of Saccharomyces cerevisiae MNN9, required for glycosylation of cell wall mannoproteins. J. Bacteriol. 181:7439-7448.[Abstract/Free Full Text]
  158. 80
  159. Stuart, W. D., K. Koo, and S. J. Vollmer. 1988. Cloning of mtr, an amino acid transport gene of Neurospora crassa. Genome 30:198-203.[Medline]
  160. 81
  161. Sugiyama, Y., S. Nakashima, F. Mirbod, H. Kanoh, Y. Kitajima, M. A. Ghannoum, and Y. Nozawa. 1999. Molecular cloning of a second phospholipase B gene, caPLB2 from Candida albicans. Med. Mycol. 37:61-67.[CrossRef][Medline]
  162. 82
  163. Tachikawa, H., Y. Takeuchi, W. Funahashi, T. Miura, X. D. Gao, D. Fujimoto, T. Mizunaga, and K. Onodera. 1995. Isolation and characterization of a yeast gene, MPD1, the overexpression of which suppresses inviability caused by protein disulfide isomerase depletion. FEBS Lett. 369:212-216.[CrossRef][Medline]
  164. 83
  165. te Heesen, S., R. Knauer, L. Lehle, and M. Aebi. 1993. Yeast Wbp1p and Swp1p form a protein complex essential for oligosaccharyl transferase activity. EMBO J. 12:279-284.[Medline]
  166. 84
  167. Treton, B. Y., M. T. Le Dall, and C. M. Gaillardin. 1992. Complementation of Saccharomyces cerevisiae acid phosphatase mutation by a genomic sequence from the yeast Yarrowia lipolytica identifies a new phosphatase. Curr. Genet. 22:345-355.[CrossRef][Medline]
  168. 85
  169. vanden Bossche, H., F. Dromer, I. Improvisi, M. Lozano-Chiu, J. H. Rex, and D. Sanglard. 1998. Antifungal drug resistance in pathogenic fungi. Med. Mycol. 36(Suppl. 1):119-128.[CrossRef][Medline]
  170. 86
  171. Verna, J., A. Lodder, K. Lee, A. Vagts, and R. Ballester. 1997. A family of genes required for maintenance of cell wall integrity and for the stress response in Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 94:13804-13809.[Abstract/Free Full Text]
  172. 87
  173. Wang, Q., and A. Chang. 1999. Eps1, a novel PDI-related protein involved in ER quality control in yeast. EMBO J. 18:5972-5982.[CrossRef][Medline]
  174. 88
  175. Wei, Y. F., B. J. Chen, and L. Samson. 1995. Suppression of Escherichia coli alkB mutants by Saccharomyces cerevisiae genes. J. Bacteriol. 177:5009-5015.[Abstract/Free Full Text]
  176. 89
  177. Yamashita, I., K. Suzuki, and S. Fukui. 1985. Nucleotide sequence of the extracellular glucoamylase gene STA1 in the yeast Saccharomyces diastaticus. J. Bacteriol. 161:567-573.[Abstract/Free Full Text]


Eukaryotic Cell, August 2002, p. 514-525, Vol. 1, No. 4
1535-9778/02/$04.00+0     DOI: 10.1128/EC.1.4.514-525.2002
Copyright © 2002, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Chaffin, W. L. (2008). Candida albicans Cell Wall Proteins. Microbiol. Mol. Biol. Rev. 72: 495-544 [Abstract] [Full Text]  
  • Pardo, M., Monteoliva, L., Vazquez, P., Martinez, R., Molero, G., Nombela, C., Gil, C. (2004). PST1 and ECM33 encode two yeast cell surface GPI proteins important for cell wall integrity. Microbiology 150: 4157-4170 [Abstract] [Full Text]  
  • Martinez-Lopez, R., Monteoliva, L., Diez-Orejas, R., Nombela, C., Gil, C. (2004). The GPI-anchored protein CaEcm33p is required for cell wall integrity, morphogenesis and virulence in Candida albicans. Microbiology 150: 3341-3354 [Abstract] [Full Text]  
  • Galan, A., Casanova, M., Murgui, A., MacCallum, D. M., Odds, F. C., Gow, N. A. R., Martinez, J. P. (2004). The Candida albicans pH-regulated KER1 gene encodes a lysine/glutamic-acid-rich plasma-membrane protein that is involved in cell aggregation. Microbiology 150: 2641-2651 [Abstract] [Full Text]  
  • Spreghini, E., Davis, D. A., Subaran, R., Kim, M., Mitchell, A. P. (2003). Roles of Candida albicans Dfg5p and Dcw1p Cell Surface Proteins in Growth and Hypha Formation. Eukaryot Cell 2: 746-755 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Monteoliva, L.
Right arrow Articles by Pla, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Monteoliva, L.
Right arrow Articles by Pla, J.