Role of Histone Deacetylation in Developmentally Programmed DNA Rearrangements in Tetrahymena thermophila

In Tetrahymena, as in other ciliates, development of the somaticmacronucleus during conjugation involves extensive and reproduciblerearrangements of the germ line genome, including chromosomefragmentation and excision of internal eliminated sequences(IESs). The molecular mechanisms controlling these events arepoorly understood. To investigate the role that histone acetylationmay play in the regulation of these processes, we treated Tetrahymenacells during conjugation with the histone deacetylase inhibitortrichostatin A (TSA). We show that TSA treatment induces developmentalarrests in the early stages of conjugation but does not significantlyaffect the progression of conjugation once the mitotic divisionsof the zygotic nucleus have occurred. Progeny produced fromTSA-treated cells were examined for effects on IES excisionand chromosome breakage. We found that TSA treatment causedpartial inhibition of excision of five out of the six IESs analyzedbut did not affect chromosome breakage at four different sites.TSA treatment greatly delayed in some cells and inhibited inmost the excision events in the developing macronucleus. Italso led to loss of the specialized subnuclear localizationof the chromodomain protein Pdd1p that is normally associatedwith DNA elimination. We propose a model in which underacetylatednucleosomes mark germ line-limited sequences for excision.

INTRODUCTION

Top

Introduction

The eukaryotic genome is packaged into repeated nucleosomalunits that are folded in high-order chromatin fibers. The dynamicsof chromatin structure plays a fundamental role in many aspectsof genomic function (reviewed in references 34 and 53). Posttranslationalmodifications of the N-terminal tails of all core histones providethe nucleosome core particle with an enormous capacity for variability.The importance of chromatin remodeling to the regulation ofgene expression has become clear partly due to the identificationof several histone-modifying enzymes. In particular, the characterizationof two competing enzymatic activities that regulate overalllevels of histone acetylation, those of histone acetyltransferasesand histone deacetylases, has established histone acetylationas a key player in modulating transcription factor access tochromatin. Determining whether histone acetylation might alsoregulate other DNA-templated processes such as replication,repair, and recombination is of great interest. Several recentstudies have revealed that histone acetylation is crucial forthe events that accompany V(D)J recombination in mammals (35,40, 41).

The ciliated protozoa Tetrahymena thermophila provides a modelsystem to address the question of how chromatin remodeling canregulate genome-wide recombination events. This organism undergoesmassive rearrangements of its somatic genome during the sexualprocess of conjugation. The chromosomes are broken at about200 sites, and about 6,000 DNA elements (called internal eliminatedsequences, or IESs) are eliminated, resulting in the loss of15% of the germ line genome (reviewed in references 15 and 54).IESs are dispersed throughout the genome and consist of single-copyand moderately repetitive sequences ranging in size from hundredsto thousands of base pairs. Most of them possess short directrepeats at their ends, one of which is maintained in the somaticgenome after excision. Although excision occurs with precisionand reproducibility, no consensus sequences have been identifiedat or near the boundaries of the eliminated elements. However,cis-acting sequences controlling the excision process have beenrevealed for two elements that have been extensively studied,the M and R elements (9, 19, 20). The cis determinants are locateda short distance outside the ends of each element, but remarkably,their exact sequences are different for each one. Two trans-actingfactors involved in this process contain chromodomains (Pdd1p[14, 37] and Pdd3p [43]). This motif is commonly found in chromosomalproteins that help establish or maintain specialized chromatinstructures in other organisms (reviewed in reference 29). Thissuggests a connection between the formation of a specializedchromatin structure and programmed DNA excision in Tetrahymena.We imagine a scenario in which chromatin associated with germline-limited sequences is remodeled during development, allowingthe excision machinery to distinguish them from those destinedfor the somatic nucleus.

Histone acetylation levels are dramatically different betweenthe germ line and the somatic nuclei in vegetative Tetrahymenacells. High levels of acetylation are found with histones isolatedfrom the somatic nucleus, while little if any acetylation isobserved with histones from the germ line nucleus during vegetativegrowth (50). Histone acetylation is developmentally regulated.Both histone acetylase and histone deacetylase activities arebeing modulated during the course of macronuclear development(12), raising the possibility that a temporal and functionalrelationship may exist between histone acetylation and genomerearrangements. To investigate the role of histone acetylationin DNA rearrangements in Tetrahymena, we treated Tetrahymenacells during conjugation with trichostatin A (TSA) (58, 59),the histone deacetylase inhibitor that has been largely usedto increase the level of histone acetylation in living cells.We describe the effects of TSA treatment on the nuclear eventsof conjugation and on DNA rearrangements. We show that treatmentwith TSA caused failure of DNA deletion but not of chromosomebreakage. The data suggest a model in which underacetylatednucleosomes mark germ line-specific sequences for excision.

MATERIALS AND METHODS

Top

Materials and Methods

Strains and culture conditions. All growth and manipulations of Tetrahymena were performed asdescribed elsewhere (2). T. thermophila inbred B strains CU427(Chx/Chx [VI, cy-s]), CU428 (Mpr/Mpr [VII, mp-s]), and B2086(II) were used as wild-type strains in all experiments and werekindly provided by Peter Bruns (Howard Hughes Institute).

For green fluorescent protein (GFP) localization of Pdd1p, aconstruct (pBC-33) was made in the GFP vector pCGF-1 (M.-C.Yao and C.-H. Yao, unpublished data) consisting of the micronuclearrDNA vector (20) containing the GFP coding sequence controlledby flanking sequences of the Tetrahymena PDD1 gene (R. Coyneand M.-C. Yao, unpublished data). The entire PDD1 open readingframe was cloned in-frame at the 3' end of the GFP coding sequence.Upon transformation with pBC-33, the ribosomal DNA vector andflanking sequences are processed, amplified, and maintainedas ribosomal DNA minichromosomes (20). One such Tetrahymenatransformant was mated with strain CU428. At various times duringconjugation, mating cells in 1% methylcellulose were examinedby fluorescence microscopy.

TSA treatment. A stock solution of TSA (Sigma) at 1 mg/ml in 100% dimethylsulfoxide was kept at -20°C. Just before use, TSA was dilutedin 10 mM Tris-HCl at pH 7.4 and added at various times to synchronouslymating wild-type cells ( $~$ 10⁵ pairs/ml) to a final concentrationof 1 µg/ml. Addition of dimethyl sulfoxide without TSA(referred to as -TSA) at the same concentration was performedin parallel as a control. Normal mating in 10 mM Tris-HCl atpH 7.4 (referred to as untreated cells) was also performed accordingto published methods (2). Prestarved cells mixed in the presenceof 1 µg of TSA/ml failed to form pairs. In the absenceof TSA, about 95% of the cells paired within the first hourafter mixing. The addition of TSA was carried out on cells thathad already paired, beginning at 3 h after mixing. Synchronyand progression through conjugation were assessed by fluorescencemicroscopy after fixation of cells in saturated HgCl₂-95% ethanol(2:1) or in 70% ethanol and staining with 4 µg of DAPI(4',6'-diamidino-2-phenylindole)/ml. After incubation, individualcells were isolated and transferred into $~$ 30-µl drops ofSPP medium (1% proteose peptone, 0.2% dextrose, 0.1% yeast extract,0.003% sequestrene) on a petri dish and were allowed to completeconjugation and grow at 30°C. After 3 days, the number ofdrops with viable cells was scored (viability). They were replica-platedinto drops of medium containing cycloheximide (25 µg/ml)or 6-methylpurine (15 µg/ml). After 3 days, successfulmating resulted in progeny showing resistance to both drugs.The production of progeny was calculated as the percentage ofviable cells that are resistant to both drugs. Whole-cell DNAswere then isolated from pools of $~$ 100 progeny lines and analyzedby Southern blotting. In some cases, single cells were isolatedfrom progeny lines and grown for DNA analysis.

Whole-cell DNA isolation. Ten milliliter cultures of vegetatively growing (5 x 10⁵ to10⁶ cells/ml) or mating cells ( $~$ 2 x 10⁵ cells/ml) were centrifuged.Cell pellets were resuspended in 0.5 ml of freshly made lysissolution (0.5 M EDTA, 10 mM Tris [pH 9.5], 1% sodium dodecylsulfate [SDS], 0.5 mg proteinase K/ml [Merck]). The lysateswere incubated at 55°C overnight. Addition of 0.5 ml of20% polyethylene glycol 8000-1.2 M NaCl-20 mM EDTA and chillingon ice for 1 h was followed by centrifugation at 15,000 x gfor 15 min and two successive washes of the pellet with 70%ethanol. The DNA pellet was resuspended in 400 µl of Tris-EDTAbuffer (10 mM Tris-HCl, 1 mM EDTA [pH7.4]). DNA was treatedwith RNase at 37°C for 1 h after the addition of 100 µlof 1.5 M sodium acetate-0.1 M EDTA-50 mM Tris-HCl (pH 8.0)-0.45mg of RNase/ml. After phenol chloroform extraction, DNA wasprecipitated with 100% ethanol and resuspended in 150 µlof Tris-EDTA buffer.

Southern blot analysis. DNAs were digested with restriction enzymes under the conditionsindicated by the suppliers. Fragmented DNAs were separated byelectrophoresis on 0.8 to 1% agarose gels. DNA fragments weretransferred from agarose gels to Hybond N⁺ membranes (Amersham)in 0.4 N NaOH after depurination in 0.25 N HCl. Hybridizationwas carried out in 7% SDS-0.5 M sodium phosphate-1% bovine serumalbumin-1 mM EDTA (pH 7.2) at 65°C. Membranes were washedthree times in 0.2x SSC (1x SSC is 0.15 M NaCl plus 0.015 Msodium citrate)-0.5% SDS for 1 h at 65°C prior to autoradiography.Specific DNA fragments used as hybridization probes were radiolabeledusing [ ${alpha}$ -³²P]dATP (3,000 Ci/mmol) and random hexamers (Gibco/BRL)as previously described (18). Probes used were as follows: probea was a HindIII-XbaI restriction fragment containing 1.2 kbpof macronuclear DNA from the M element (57), probe b was a AccI-EcoRIrestriction fragment containing $~$ 1 kbp of macronuclear DNA fromthe R element (57), and probe c consists of a 2.5-kbp fragmentcontaining the entire coding sequence for the PGM1 gene (13)that was amplified from Tetrahymena genomic DNA by PCR and clonedinto pCRII-TOPO (Invitrogen) (see Fig. 3).

View larger version (14K):
[in this window]
[in a new window]
FIG. 3. Maps of the micronuclear and macronuclear versions of the genomic region containing the M and R elements (top panel) and of the genomic region containing the PGM1 element (bottom panel). Micronuclear specific elements are represented by open boxes. The M element is excised from the micronuclear genome in two alternative forms of 0.6kbp (M_mac ${Delta}$ 0.6) and 0.9 kbp (M_mac ${Delta}$ 0.9). The positions and lengths of probes a, b, and c are shown. HindIII (H) restriction sites are indicated.

PCR analysis of total genomic DNA. Two oligonucleotides (5' AGCTTAAACAAATGCCATATTGAG 3' and 5'GTGGGGAGGGAGAAGATTCAAAC 3') located 240 bp from the 5' boundaryand 25 bp from the 3' boundary of the M element, respectively,were used to perform PCR amplification at different time pointsduring conjugation. PCRs were carried out in 0.2 ml polypropylenetubes (USA Scientific) with reaction mixtures (25 µl)containing $~$ 100 ng of whole-cell DNA, 1x PCR buffer (Gibco/BRL),0.2 mM of deoxynucleoside triphosphates, 0.5 µM of primer,and 2.5 U of Taq polymerase (Gibco/BRL). Amplifications weredone in a Perkin-Elmer GeneAmp PCR system apparatus as follows:94°C for 4 min followed by 30 cycles of 30 s at 94°C,30 s at 55°C, and 30 s at 72°C and a final terminationcycle of 7 min at 72°C.

RESULTS

Top

Results

Effects of TSA treatment on conjugating cells. Since the effects of TSA treatment on the life cycle of Tetrahymenahave never been reported, we investigated the process of conjugationin the presence of TSA. Vegetative Tetrahymena cells containtwo types of nuclei within the same cytoplasm: the somatic macronucleus,responsible for transcription, and the germ line micronucleus,transcriptionally silent during vegetative growth. During conjugation,new macronuclei and micronuclei are generated through a seriesof nuclear events that are described below (Fig. 1) (22, 39).Conjugation is initiated by mixing prestarved cells of compatiblemating types. After meiosis of the micronucleus, mating pairsexchange one of their haploid nuclei to form the diploid zygoticnuclei. All the prezygotic events are completed within the first5 to 6 h after mixing. The zygotic nucleus divides twice mitoticallyto give rise to four nuclei; two differentiate into new macronucleiand the other two differentiate into new micronuclei. The developmentof the new macronucleus can be divided into three cytologicalstages (see Fig. 1) during which DNA rearrangements (between12 and 14 h after mixing) (3) and DNA endoduplication also occur.The old macronucleus condenses and is eventually resorbed. Themating pair separates during this time, and one of the two micronucleiin each cell is eliminated. When cells divide after refeedingwith growth medium, the two new macronuclei segregate to thedaughter cells, while the micronucleus undergoes mitosis. Onemicronucleus and one macronucleus are present in each cell asvegetative growth resumes.

View larger version (29K):
[in this window]
[in a new window]
FIG. 1. TSA treatment of conjugating cells at 3 h after mixing causes cells to arrest in metaphase of meiosis I. The developmental stages of conjugation previously described in references 22 and 39 are schematically represented as follows. Lanes: 1, cell pairing; 2, crescent stage (prophase of meiosis I); 3, metaphase of meiosis I; 4, end of meiosis II; 5, prezygotic mitosis of one of the four haploid nuclei; 6, karyogamy; 7, macronuclear development I, which is distinguished by the central location of the parental macronucleus, the anterior location of the new macronuclei, and the posterior location of the new micronuclei; 8, macronuclear development II, in which the parental macronucleus condenses and paired cells separate; 9, macronuclear development III, which begins when the parental macronucleus has been resorbed; 10, the final new macronucleus stage, in which one of the two micronuclei is eliminated and the new macronuclei have undergone DNA amplification. The percentage of cells in each cytological stage was determined after fixing and staining with DAPI. At least 200 pairs were scored for each time point by fluorescence microscopy. About 95% of the cells paired within the first hour after mixing. The white rectangles show the untreated cells. The black rectangles show the outcome for cells treated with TSA at 3 h after mixing for 2 h (until 5 h after mixing) and for 4 h (until 7 h after mixing).

To examine the effects of TSA treatment on the nuclear eventsof conjugation, mating cells were incubated in the presenceof TSA at 1- or 2-h intervals (beginning at 3 h and continuinguntil 12 h after mixing). The treatment was done either for4 h or continued until 24 h after mixing (the later is referredto as continuous treatment). After TSA treatment, individualmating cells were cloned into fresh medium without TSA and allowedto complete conjugation and grow. Cell viability as well asprogeny production were quantified from two or more separateexperiments, and the results are shown in Fig. 2.

View larger version (17K):
[in this window]
[in a new window]
FIG. 2. Genetic analysis of the effects of TSA treatment during conjugation. TSA was added to mating cells at various times (beginning at 3 h and continuing until 12 h after mixing) as indicated in the abscises in both graphs (A and B). The treatment was either for 4 h (triangles) or continued until 24 h after mixing (squares). Control samples are represented by circles. After treatment, individual mating pairs were cloned and the percentages of pairs giving viable cells were scored (A). The percentages of mating pairs that successfully produced sexual progeny (see Materials and Methods) are also given (B). The number of cells analyzed for each point was between 88 and 352. The results are the combined totals of two or more experiments. The discrepancy in the percentage of viability between the 4-h treatment (low viability) and the treatment until 24 h (high viability) for cells treated at 5 h after mixing may be due to bias introduced during cell cloning. At 24 h, many dying or dead cells were already immobile and thus not cloned, which raised the percentage of viable cells among those cloned.

Mating cells treated with TSA before 6 h after mixing producedfewer viable cells than the control and very few progeny inboth the 4-h treatment and the continuous treatment. Consistentwith these data, cytological examination of these cells neverrevealed new macronucleus formation. The stages of developmentalarrest were complex. One striking observation came from theTSA treatment applied at 3 h after mixing and is illustratedin Fig. 1. At 3 h after mixing, the majority of the cells (90%)were in the prophase of meiosis I (crescent stage). Incubationwith TSA caused cells to arrest in the metaphase of meiosisI after 2 h of treatment (87%), while control cells had alreadycompleted meiosis. Even after 4 h of treatment, TSA-treatedcells did not progress further (87% are still in metaphase).Mating cells incubated with TSA at 4 and 5 h after mixing werestill paired in some cases and contained in most cases one ortwo enlarged macronuclei by the 24-hour point.

In contrast, mating cells treated with TSA after 6 h after mixing,the time at which postzygotic division had taken place in 75%of the cells (Fig. 1), showed a different outcome. Many treatedcells survived and produced true progeny. Cell viability andprogeny production were significantly lower after the continuoustreatment than after the 4-h treatment. Cytological examinationshowed little difference with the untreated controls: the pairsseparate, the old macronucleus disappears, and the second micronucleusis eliminated with a similar timing. The only exception is thatone of the micronuclei is not eliminated in cells that are treatedfrom 6 h to 24 h after mixing. In summary, TSA treatment hascatastrophic effects on the early stages of conjugation butdoes not significantly affect progression of conjugation oncemitotic division of the zygotic nucleus has occurred.

Excision inhibition by TSA treatment. Since mating cells treated with TSA after 6 h after mixing producedprogeny, we were able to examine whether the histone deacetylaseinhibitor affects developmentally regulated genome rearrangements.For that purpose, we analyzed the new macronuclear genome ofthe sexual progeny produced after TSA treatment. Sexual progenyof approximately 100 mating cells treated at 6 h or later (i.e.,at 6, 8, 10, and 12 h after mixing) for 4 h or continuouslyuntil 24 h were grown individually and then mixed for DNA extraction.DNA samples were first analyzed for IES excision by Southernhybridization. The results of hybridization of Southern blotswith a probe specific for the M element (probe a, Fig. 3) areshown in the top panels of Fig. 4A and B. Figures 4A and B showthe results from the 4-h and the continuous treatment experiments,respectively. Because the micronucleus-macronucleus ploidy is $~$ 1:20, most of the hybridizing DNA is macronuclear DNA. The Melement is eliminated from the micronuclear genome during macronucleardevelopment in two alternative forms (0.6 kbp and 0.9 kbp) thatshare a common right boundary (see Fig. 3) (3, 5). The parentalstrains (CU427 and CU428) used in this mating contain the macronuclearfragment corresponding to the 0.6-kbp deletion (M_mac ${Delta}$ 0.6), whereasanother standard strain (B2086) contains the 0.9-kbp deletionproduct in its macronuclear genome (M_mac ${Delta}$ 0.9). The sexual progenyof untreated cells (Fig. 4A and B, top panels) showed both macronuclearfragments in roughly equal amounts, as expected (3). The sexualprogeny of cells treated for 4 h with TSA gave similar results,indicating that the M element was correctly excised during macronucleardevelopment (Fig. 4A, top panels). In contrast, the sexual progenyof cells treated continuously until 24 h after mixing (Fig.4B, top panel) showed a significant amount (about 30%) of unrearrangedDNA (M_mic). Thus, continuous TSA treatment starting at 6 or8 h and lasting until 24 h after mixing caused some copies ofthe M element to be retained in the new macronuclear genomeof the sexual progeny, whereas TSA treatment applied after 10h after mixing did not.

View larger version (47K):
[in this window]
[in a new window]
FIG. 4. TSA treatment impairs IES excision. Southern hybridization analysis was used to monitor the effect of TSA treatment on the excision of the M, R, and PGM1 elements. Control DNA samples were isolated from vegetative CU427, CU428, and B2086 strains. Experimental DNA samples were isolated from the progeny of cells that were treated at 6 h, 8 h, 10 h, and 12 h after mixing with TSA (+TSA) and without TSA (-TSA) as indicated. Each sample represents a pool of about 100 progeny lines. Total DNA was digested with HindIII. The positions of the DNA fragments corresponding to the unrearranged forms (M_mic, R_mic, and PGM1_mic) and the rearranged forms (M_mac, R_mac, and PGM1_mac) are indicated by arrows. Among the different HindIII macronuclear fragments revealed by probe c, only the macronuclear fragment containing the PGM1 element is indicated by the arrow as PGM1_mac. Conjugating cells were treated for 4 h (A) or continuously until 24 h after mixing (B). The same blot was successively hybridized with probes a, b, and c (Fig. 3) in both panels A and B.

To determine the effect of TSA on the excision of other IESs,the same blots were stripped and successively rehybridized withtwo other probes. Probe b was specific for the region containingthe 1.1-kbp R element located $~$ 2.5 kbp away from the M element(3, 4), and probe c was specific for the region containing the2.5-kbp element located within an intron of the PGM1 gene locatedin a different genomic region (13) (Fig. 3). Both the micronuclear(R_mic) and the macronuclear (R_mac) forms were found in the sexualprogeny of cells treated with TSA from 6 to 10 h and from 8to 12 h after mixing, indicating that the excision of the Relement was partially inhibited (Fig. 4A, middle panel). Theexcision of the PGM1 element was affected only in the sexualprogeny of cells treated between 6 and 10 h after mixing (bottompanel of Fig. 4A). Thus, the 4-h TSA treatment partially inhibitedthe excision of both these elements, even though it had no effecton the excision of the M element. Continuous treatment withTSA beginning from 6 to 8 h after mixing partially affectedthe R and PGM1 deletion elements (Fig. 4B, middle and bottompanels), as was the case with the M element. In all cases, theprogeny of cells treated with TSA at 10 h and 12 h were notaffected.

Three other IESs were analyzed similarly (data not shown). Theexcision of two (24, 33) IESs was also impaired when cells weretreated before the 10-h stage. The excision of the third elementanalyzed (23) was not affected. Since this element is locatedwithin an intron of a gene of unknown function, it is possiblethat its excision is essential for the cells to grow, whichwould prevent us from recovering cells that had retained theelement. However, analysis of DNA from cells isolated at the24-h point (before selection for growth) showed that the excisionwas not affected (data not shown). Thus, the excision of thiselement was not sensitive to TSA treatment.

In summary, treatment of mating cells with TSA caused partialfailure of excision for five out of the six IESs analyzed inthis study. This blockage depends on the time at which the treatmenthas been applied to mating cells (see below). In none of thesamples analyzed was the inhibition of excision complete forany IESs. Similar experiments using increasing concentrationsof TSA (up to a tenfold increase) did not show an increaseddefect of excision in the sexual progeny (data not shown). Thepartial failure of excision could be attributable to the factthat we were unable to treat cells with TSA earlier than 6 hafter mixing without arresting development. Alternatively, therecould be other deacetylase activities that are insensitive toTSA that play a role in the process (8, 25).

Since pools of 100 progeny were used in this analysis, therecould be some heterogeneity among them, with some cells showingcomplete failure of excision and other cells no failure of excision.To assess this possibility, we isolated individual cells fromsome pools that showed partial failure of excision for the M,R, and PGM1 elements. DNAs of four such subclones derived fromcells treated from 6 h until 24 h were analyzed by using Southernblotting (Fig. 5). Of these lines, some indeed showed completefailure of excision for the R and PGM1 elements (Fig. 5, lanes1 and 3 for R and lanes 1, 2, and 4 for PGM1). In one cell linein which most copies of the R and PGM1 elements were not deleted,the M element deletion was not affected (Fig. 5, lane 1). Thissuggests that TSA treatment causes differential failure of excisionfor each IES within the same developing macronucleus.

View larger version (37K):
[in this window]
[in a new window]
FIG. 5. Effect of TSA treatment on IES excision in individual progeny. The excision of the M, R, and PGM1 elements was analyzed by Southern hybridization in four individual cell lines (lanes 1 to 4) isolated from the sexual progeny of cells treated with TSA from 6 h until 24 h after mixing. Total DNA was digested with HindIII. The same blot was successively hybridized with probes a, b, and c (Fig. 3). The positions of the DNA fragments corresponding to the unrearranged and the rearranged forms of each element are indicated by the arrows. An aberrant form of rearrangement revealed by probe b is marked by an asterisk.

TSA treatment does not affect chromosome breakage. So far, we have investigated the role of TSA treatment on IESexcision. To test the specificity of this effect, we examinedthe occurrence of the other major type of DNA rearrangement,chromosome breakage, using the same DNA samples. During macronucleardevelopment, chromosome breakage occurs at sites containingthe 15-bp chromosome breakage sequence Cbs (55, 56). Telomeresare then added to both free ends about 5 to 20 bp from the endsof Cbs (17). Consequently, a Cbs and 10 to 40 bp of DNA surroundingit are eliminated. Southern blots were hybridized with severalprobes that contain a Cbs and its macronuclear flanking sequences(56). Probe 835a revealed two macronuclear fragments that containtelomeres (major bands) as well as its micronuclear counterpart(a minor band), as shown in the control samples of Fig. 6. Whateverthe duration of the treatment (4 h or continuous treatment [Fig.6A and B, respectively]), the sexual progeny of TSA-treatedcells showed the same pattern of hybridization as the sexualprogeny of the untreated cells. We analyzed three other Cbssites (56) and did not detect any failure in chromosome breakage.Analysis of developing macronuclei at the 24-h point also didnot show any defect in chromosome breakage (data not shown),indicating that the absence of effect is likely not due to selectionfor growth. We therefore conclude that the process of chromosomebreakage is not sensitive to TSA, which highlights the specificityof TSA treatment on the excision process.

View larger version (96K):
[in this window]
[in a new window]
FIG. 6. TSA treatment does not affect chromosome breakage. Southern hybridization analysis was used to monitor chromosome breakage in sexual progeny of cells treated with TSA (+TSA) or without TSA (-TSA) for 4 h (panel A) or until 24 h (panel B). On the schematic representation of chromosome breakage, the 15-bp chromosome breakage site, Cbs, is drawn as a black box. The two macronuclear chromosomes generated after breakage are shown with hatched boxes designating telomeric repeats. All samples were digested with EcoRI. DNA samples in panel A are the same as in Fig. 4A, and DNA samples in panel B are the same as in Fig. 4B. Both blots were hybridized with probe 835a (56). The precise map and sequence of that genomic region have not been determined.

Excision events are delayed in the presence of TSA. To better understand how TSA treatment affects IES excision,we looked at the excision process directly during macronucleardevelopment. As described above, the failure of excision dependson the time of the addition of TSA to mating cells. It has beenpreviously reported that the excision of the M and R elementsnormally occurs between 12 and 14 h after mixing (3). We addedTSA at 6 h after mixing, and DNA was isolated from the matingcultures at 9, 10, 11, 12, 13, 14, and 24 h after mixing. Todistinguish the new macronuclear junctions generated by excisionfrom the sequences of the parental macronucleus that are alsopresent in these cells, we took advantage of the alternativeexcision of the M element. The parental strains used for themating (CU427 and CU428) contained only the 0.6-kbp deletionproduct in the macronucleus (M_mac ${Delta}$ 0.6) (Fig. 7). However, bothforms, M_mac ${Delta}$ 0.6 and M_mac ${Delta}$ 0.9, were produced in the new macronucleusof their sexual progeny (3). This feature allowed us to determinethe timing of the M element excision by monitoring the appearanceof the 0.9-kbp deletion product (M_mac ${Delta}$ 0.9). We performed PCRon the DNA samples by using two oligonucleotides flanking theM element that allow the amplification of M_mic, M_mac ${Delta}$ 0.6, andM_mac ${Delta}$ 0.9. In untreated cells, M_mac ${Delta}$ 0.9 was detectable as earlyas 10 h after mixing and increased in abundance over time (Fig.7). This is consistent with our observation that partial blockageof excision occurs only when TSA is applied before the 10-hstage.

View larger version (51K):
[in this window]
[in a new window]
FIG. 7. Timing of excision of the M element in conjugating cells with and without TSA treatment. A schematic diagram of the M element is shown on the top. The oligonucleotides used for PCR are represented by arrowheads. Expected sizes of the PCR products are indicated. PCR products amplified from DNA samples of conjugating cells were run on a 1.2% agarose gel and stained with ethidium bromide. The first three lanes show the results for PCR products amplified from control vegetative cells of CU427, CU428, and B2086 strains. Indicated time points (9, 10, 11, 12, 13, 14, and 24) refer to the times in hours after mixing at which DNAs were extracted from mass mating. TSA was added at 6 h after mixing. M is the 1-kb size marker from Gibco/BRL. Two faint bands were detected in all PCR products amplified from DNA samples of conjugating cells. The uppermost band corresponds to the expected size for M_mic.

With TSA treatment, in contrast, no excision of the M elementwas observed at 10 or 14 h after mixing. However, at 24 h aftermixing, PCR product corresponding to M_mac ${Delta}$ 0.9 was detected, indicatingthat some excision of the M element had occurred. This doesnot appear to have been due to weakening of TSA during the 18-hincubation (from 6 to 24 h). To test for drug efficacy, we usedthe supernatant of similarly treated mating cultures at 24 hto treat 3-h mating cells. This treatment induced the same developmentalarrest in metaphase of meiosis as efficiently as freshly preparedTSA.

Even though some excision has occurred during TSA treatment,the amount of PCR product corresponding to M_mic was clearlymore abundant in the TSA-treated cells than in the untreatedcells at 24 h after mixing. This indicates that the developingmacronuclei at the 24-h point still contained unrearranged formsof the M element, which is consistent with the partial blockageobserved from the progeny analysis. Thus, both the timing andthe efficiency of excision were greatly affected by TSA treatment.

Pdd1p localization in the presence of TSA. Several abundant polypeptides are specifically expressed andtargeted to the developing macronuclei at the time when genomerearrangements occur (38, 43, 47). The most abundant of these,Pdd1p, is a chromodomain protein that associates with the eliminatedDNA in electron-dense intranuclear structures (37, 47) and isrequired for the excision process (14). To test the possibilitythat TSA treatment alters the ability of Pdd1p to properly interactwith chromatin at the eliminated sequences, we examined theexpression and localization of Pdd1p during TSA treatment. Byusing GFP-tagged Pdd1p (R. Coyne, D. Chalker, and M.-C. Yao,unpublished data), we are able to follow Pdd1p localizationin living cells. Consistent with previously reported Pdd1p immunolocalization(38), the untreated cells initially showed uniform distributionof GFP in the developing macronucleus. As conjugation progressed,the GFP became punctate, culminating with the appearance oflarge spherical structures at 14 h after mixing that containmicronuclear-limited sequences (Fig. 8A). In contrast, the GFPwas uniformly distributed in the developing macronucleus at14 h after mixing in TSA-treated cells (Fig. 8B). Quantitationusing a fluorescence microscope showed that 92/110 of the untreatedcells had a punctate pattern, whereas 0/200 of the TSA-treatedcells had a similar pattern at 14 h after mixing. Thus, TSAtreatment did not seem to inhibit Pdd1p expression but resultedin loss of the special Pdd1p localization that is correlatedwith DNA elimination. However, at 24 h after mixing, GFP hada punctate pattern in a fraction of cells treated with TSA (29/111),but not in any cells without TSA (0/100). Thus, the subnuclearstructures associated with Pdd1p and DNA deletion did not format the normal time, although they could still form at a latertime in a fraction of cells. We conclude that TSA treatmentleads to the inhibition of excision and the loss of the subnuclearlocalization of Pdd1p in most cells. In some cells it delaysthe timing of IES excision and, concomitantly, the formationof the Pdd1p-associated nuclear structures.

View larger version (104K):
[in this window]
[in a new window]
FIG. 8. Pdd1p localization in conjugating cells incubated without (A) and with TSA (B). Cells expressing Pdd1p fused to GFP were mated with wild-type cells, and TSA was added at 6 h after mixing. At 14 h after mixing, cells are examined under a fluorescence microscope.

DISCUSSION

Top

Discussion

The role of histone deacetylation in genome rearrangements inTetrahymena has been investigated here by using trichostatinA, a potent and specific inhibitor of histone deacetylase. Thisdrug has been widely used to study the role of histone acetylationin gene expression. It has been shown in some cases and assumedin the others that TSA treatment increases the overall levelof histone acetylation by inhibiting histone deacetylase activities(58, 59). The present study demonstrates that histone deacetylationplays an important role in the regulation of the developmentallyprogrammed DNA deletion process in Tetrahymena. Incubation withTSA causes failure of excision of several IESs in the macronucleargenome of the sexual progeny of the treated cells. This effectis specific, since TSA treatment does not affect chromosomebreakage at the four sites analyzed. It has previously beendemonstrated that the M and R elements can be maintained inthe macronuclear genome (10). Here we show that Tetrahymenacells containing several IESs in their macronuclear genome areviable and able to grow vegetatively. The excision inhibitioninduced by TSA treatment is partial, since only a fraction ofthe macronuclear chromosomes contain the micronuclear-specificsequences. However, we have obtained individual cell lines inwhich the failure of excision can be complete for some IESs.Since the excision of five IESs out of six analyzed was affectedby the histone deacetylase inhibitor, it raises the possibilitythat the excision of many or most of the IESs that make up asmuch as 15% of the germ line genome is under the control ofhistone deacetylation.

Effects of the deacetylase inhibitor TSA on the nuclear events of conjugation. Inhibiting histone deacetylases with TSA greatly perturbed thenuclear events in early stages of conjugation. Conjugating cellstreated before the stage of the zygotic nuclear divisions failedto develop a new macronucleus and as a consequence did not produceprogeny. The developmental arrest of cells in metaphase of meiosissuggests that without proper signals the conjugants do not proceedbeyond a specific stage, probably a developmental checkpoint,and that to do so would require deacetylase activity. We identifieda stage after which developmental progression becomes insensitiveto TSA. This time point (6 h) correlates with the completionof the second postzygotic nuclear division, which is the lastnuclear division of the developmental program. Past this timepoint, the final nuclear events of conjugation proceed normallyin the presence of TSA; the differentiation of the new macronucleusand the new micronuclei take place, and the parental macronucleusis eliminated as well as one of the two micronuclei.

Other drug treatments have been shown to block macronucleardevelopment. Nocodazole is an antimicrotubule drug that preventsmacronuclear differentiation when applied before the formationof the zygotic nucleus (30, 32). Cycloheximide and actinomycinD, inhibitors of protein and RNA synthesis, respectively, arealso capable of arresting development when applied before thesecond postzygotic division (31, 51). Interestingly, actinomycinD and cycloheximide treatments cause the same developmentalarrest in metaphase of meiosis as TSA (31). In all treatments,the second zygotic division is the point past which developmentcan no longer be prevented. What is remarkable is the fact thatpostzygotic events of the developmental program are able toproceed in the presence of TSA, whereas the genomic rearrangementsin the developing macronucleus do not occur normally. In a similarmanner, brief actinomycin D treatment of conjugating cells canblock the excision process without dramatic effects on the formationof a new macronucleus (11). The nuclear events can thereforebe dissociated from the rearrangement program.

A connection between histone acetylation and cell differentiationhas long been known. TSA treatment promotes cell line differentiation(60) and restricts cell transformation (48). In Xenopus (1),inhibiting histone deacetylation with TSA during developmentgreatly perturbs the differentiation program during gastrulation.It is not clear how TSA treatment causes these effects. Studiesin both Schizosaccharomyces pombe (16) and mammalian cell cultures(49) indicate that TSA treatment leads to defects in chromosomesegregation in mitosis. The effects of TSA treatment can thusbe explained both by the role of histone acetylation in transcriptionregulation and by the control of the acetylation state of histonesthat is necessary for the maintenance of genome integrity.

A role for histone deacetylation in DNA excision. TSA treatment of conjugating cells indicated that histone deacetylationis necessary for efficient excision of five different IESs.Interestingly, histone acetylation has been shown to play animportant role in the regulation of another developmentallyprogrammed DNA rearrangement, the V(D)J recombination of thegenes encoding T cell receptors and immunoglobulins (reviewedin reference 46). TSA has been shown to enhance V(D)J recombination(40), and acetylation of histone H3 is known to accompany specificrecombination events (41). More recently it has been demonstratedthat histone acetylation acts in concert with the ATP-dependentremodeling factor SWI/SNF to increase the initial recombinationreaction in vitro (35). Histone acetylation accompanies theactivation of V(D)J recombination, while histone deacetylationis required for efficient IES excision. The detailed mechanismsby which histone acetylation regulates genome rearrangementsseem to be clearly distinct in these two instances.

How might histone acetylation inhibit IES excision? Increasedlevels of histone acetylation could perturb the expression ofgenes that are involved in the excision process and consequentlycause failure of excision. At this point we cannot completelyrule out the possibility that the effect of TSA is indirect.However, the fact that the 4-h TSA treatment can block the excisionof several IESs without having a severe effect on progeny productionargues against a general effect of TSA on the expression ofgenes essential for development.

We favor another explanation, in which the increased histoneacetylation affects the nucleosomes that are associated withIESs, directly causing inhibition of excision. One might expectthat histone acetylation levels would not increase with TSAtreatment in regions of the micronuclear genome that are neversubject to acetylation. Inhibiting histone deacetylase activitieswith TSA treatment would not cause any alterations of the nucleosomesassociated with IESs located in these regions. The one IES whoseexcision was insensitive to TSA in our experiment may well beone such example. Our data showed that histone deacetylationbetween 6 and 10 h of conjugation was required for efficientexcision. This is just before the time IESs are actually excisedfrom the developing macronucleus, as shown in our PCR assayfor the M element (Fig. 7). We propose that IESs are associatednormally with underacetylated histones, at least transientlyduring macronuclear development. This regulated deacetylationof histones would establish a mark that distinguishes the sequencesto be eliminated from the macronucleus-destined sequences. Specificpatterns of histone acetylation are maintained in differentregions of eukaryotic genomes. Histones in heterochromatic regionsin widely divergent species are consistently underacetylated.In mammalian metaphase chromosomes, histones H3 and H4 are underacetylatedat all lysines in both constitutive heterochromatin and thefacultative heterochromatin of the inactive X chromosome (7,28). Underacetylation of histones H3 and H4 has also been implicatedin the formation of heterochromatin in both Schizosaccharomycespombe and Saccharomyces cerevisiae (reviewed in reference 21).Underacetylated histones may be a transient landmark of thechromatin associated with IESs in Tetrahymena at the time oftheir elimination. This analogy is further supported by theformation of electron-dense nuclear structures resembling heterochromatinwithin the developing macronucleus that contain the eliminatedsequences at the time of their excision (37, 47). In anotherciliate, Euplotes crassus, eliminated DNA may also form heterochromatin-likestructures in the developing macronucleus. Changes in nucleosomespacing for the Tec transposons of E. crassus have been detectedat the beginning of the macronuclear development (27). Moreover,the Tec elements show an unusual chromatin structure, as analyzedby micrococcal nuclease digestion, in contrast to the classicalladder of nucleosomes observed for macronuclear-destined sequences(26).

In our model, the underacetylated nucleosomes would tether theproteins that carry out the excision process. In cells treatedwith TSA, histone deacetylase activity is inhibited and increasingacetylation of associated chromatin would thus prevent the recruitmentof the excision machinery. This is in good agreement with thefact that the localization of the chromodomain protein Pdd1pis greatly affected by TSA treatment. In that respect, it isinteresting that exposure to TSA leads to the delocalizationof heterochromatin-associated proteins in Schizosaccharomycespombe (16) as well as in mammalian cells (49). Recent reportshave indicated that methylation of lysine 9 of histone H3 iscrucial in establishing a potent binding site for heterochromatinproteins (6, 36). Moreover, acetylation of lysine 9 of histoneH3 inhibits its methylation by the methyltransferase SUV39H(45). One interpretation of our data would be that the inhibitionof deacetylation prevents the methylation of histone H3 lysine9, which in turn leads to the loss of Pdd1p association withthe eliminated sequences and consequently to the failure ofexcision.

The eliminated sequences in Tetrahymena can be 1 kbp or shorterin length. Just a few modified nucleosomes would cover the entirelength of these small IESs. In contrast with the histone modificationpatterns that distinguish euchromatin and heterochromatin domainsover large regions (such as the distinct histone methylationpattern specific for the 20-kbp mating-type locus in Schizosaccharomycespombe) (44), the chromatin remodeling involved in IES excisionwould be much more localized. The deacetylase activity thatwe have revealed in this study remains to be characterized.A histone deacetylase gene homologue to the yeast RPD3 has beenisolated in Tetrahymena (52). It would be interesting to knowwhether it plays a role in IES excision. One important questionis how the deacetylase is specifically recruited to the eliminatedsequences. The fact that germ line limited sequences are transcribedbetween 3.5 and 8 h after mixing (11) may suggest that transcriptionof these sequences plays a part in the initiation of chromatinremodeling. It is possible to envision that chromatin openingassociated with transcription allows the deacetylase activityto be targeted to specific locations in the genome.

Our finding that IES excision is regulated by histone deacetylationcould be relevant to the intriguing epigenetic regulation ofthis process exerted through the maternal macronucleus. Theexcision of the M and R elements can be inhibited during conjugation,when these elements are introduced into the maternal macronucleusprior to mating (10). The molecular basis for this homology-dependentmaternal effect is not yet elucidated. It will be of great interestto explore the possibility that histone modifications play arole in the epigenetic regulation of IES excision. Pairing interactionsbetween molecules produced from the maternal macronucleus andunrearranged homologous sequences have been postulated to accountfor the sequence specificity of the phenomenon (reviewed inreferences 42 and 54). We speculate that these pairing interactionsinhibit the excision events by interfering with histone modifications,thus altering the proper packaging of nucleosomes associatedwith the sequence to be eliminated.

ACKNOWLEDGMENTS

We thank Douglas Chalker for critical reading of the manuscript.

This work was supported by grant GM26210 to M.-C. Yao from theNational Institutes of Health. S.D. was a recipient of fellowshipsfrom the Association pour la Recherche sur le Cancer and HumanFrontier Science Program.

FOOTNOTES

* Corresponding author. Present address: Laboratoire de Génétique Moléculaire, Ecole Normale Supérieure, 46 rue d'Ulm, 75005 Paris, France. Phone: (33) 1 44 32 39 47. Fax: (33) 1 44 32 39 41. E-mail: duharcou{at}wotan.ens.fr.

REFERENCES

Top