This Article
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow E-mail this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hirose, S.
Right arrow Articles by Maeda, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hirose, S.
Right arrow Articles by Maeda, Y.

 Previous Article  |  Next Article 

Eukaryotic Cell, August 2005, p. 1477-1482, Vol. 4, No. 8
1535-9778/05/$08.00+0     doi:10.1128/EC.4.8.1477-1482.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Transcriptional Switch of the dia1 and impA Promoter during the Growth/Differentiation Transition

Shigenori Hirose,1,{dagger} Taira Mayanagi,2,{dagger} Catherine Pears,3 Aiko Amagai,2 William F. Loomis,1* and Yasuo Maeda2

Cell and Developmental Biology, Biological Sciences, University of California, San Diego, 9500 Gilman Drive, La Jolla California 92093-0368,1 Department of Developmental Biology and Neurosciences, Graduate School of Life Sciences, Tohoku University, Aoba, Sendai 980-8578, Japan,2 Biochemistry Department, Oxford University, South Parks Road, Oxford OX1 3QU, United Kingdom3

Received 6 April 2005/ Accepted 23 May 2005

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.


* Corresponding author. Mailing address: Cell and Developmental Biology, UCSD, 9500 Gilman Drive, La Jolla, CA 92093-0368. Phone: (858) 534-2543. Fax: (858) 822-2094. E-mail: wloomis{at}ucsd.edu.

{dagger} These authors contributed equally to this work.


Eukaryotic Cell, August 2005, p. 1477-1482, Vol. 4, No. 8
1535-9778/05/$08.00+0     doi:10.1128/EC.4.8.1477-1482.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.




This article has been cited by other articles:

  • Hirose, S., Payne, S. H., Loomis, W. F. (2006). cis-Acting Site Controlling Bidirectional Transcription at the Growth-Differentiation Transition in Dictyostelium discoideum.. Eukaryot Cell 5: 1104-1110 [Abstract] [Full Text]